Plant Pathol J > Volume 32(1); 2016 > Article
Park, Gupta, Krishna, Kim, Lee, Hwang, Bae, and Ahn: Proteome Analysis of Disease Resistance against Ralstonia solanacearum in Potato Cultivar CT206-10

Abstract

Potato is one of the most important crops worldwide. Its commercial cultivars are highly susceptible to many fungal and bacterial diseases. Among these, bacterial wilt caused by Ralstonia solanacearum causes significant yield loss. In the present study, integrated proteomics and genomics approaches were used in order to identify bacterial wilt resistant genes from Rs resistance potato cultivar CT-206-10. 2-DE and MALDI-TOF/TOF-MS analysis identified eight differentially abundant proteins including glycine-rich RNA binding protein (GRP), tomato stress induced-1 (TSI-1) protein, pathogenesis-related (STH-2) protein and pentatricopeptide repeat containing (PPR) protein in response to Rs infection. Further, semi-quantitative RT-PCR identified up-regulation in transcript levels of all these genes upon Rs infection. Taken together, our results showed the involvement of the identified proteins in the Rs stress tolerance in potato. In the future, it would be interesting to raise the transgenic plants to further validate their involvement in resistance against Rs in potato.

Potato (Solanum tuberosum L.) is third most important crops worldwide following maize and rice (FAO Crops statistics database: http://faostat.fao.org/). The productivity and quality of potatoes are affected by a number of constraints including biotic and abiotic stresses. Ralstonia solanacearum (Rs) is one of soil borne pathogen which causes bacterial wilt in numbers of solanaceae and non-solanaceae plants, resulting in huge loss of their productivity (Wenneker et al., 1999). Rs is a heterogeneous species, subdivided into five races and five biovars based on the host range and ability to utilize carbohydrates respectively (Hayward, 1991). R3bv2, a subgroup of Rs which especially causes bacterial wilt in potato in tropical regions of Asia, Africa and Latin America (Champoiseau et al., 2009). However, the outbreaks of this disease has been noticed sometimes even in the temperate regions (Elphinstone et al., 1996; Laferriere et al., 1999). The global damage estimated with this disease is more than $ 1 billion/year (Elphinstone et al., 2005). There is no any effective means developed so far to protect the potato plants from this devastating disease.
Plants respond to pathogens by exhibiting various changes at molecular and physiological levels. Various studies have been conducted in potato to investigate differential transcripts expression upon different pathogenic infections. Phytophthora infestans which causes late blight disease in potato showed up-regulation of 2,344 transcripts upon infection which belongs to stress inducible protein, zinc finger transcription factor, heat stress transcription factor, defense related protease and pathogenesis related proteins (Siddappa et al., 2014). In other reports, transcripts level of osmotin like protein (El-Komy et al., 2010) and Lipoxygenase (Kolomiets et al., 2000) were shown to be up-regulated upon P. infestans infection. Potato plant infected with Fusarium solani f. sp. eumartii showed up-regulation of gene coding for heat shock and ribosomal proteins (D’Ippolito et al., 2011).
There are only few reports on differential proteins expression in potato under pathogen infections. Quantitative transcriptomics and proteomics of potato in response to P. infestans showed change in abundance of more than 17,000 transcripts and 1,000 secreted proteins. Major identified proteins were related to subtilase, peroxidase and protease inhibitor families (Ali et al., 2014). Aspartic proteinase content and its activity have been reported to increase in potato upon P. infestans infection (Guevara et al., 2004). Inductions of metallocarboxypeptidase protein from potato cultivar bintje, and β-glucosidase and transcription activator PTI6 from late bright resistant genotype of potato have also been reported upon P. infestans infection (Taoutaou et al., 2011).
To the best of our knowledge, there is no report on differential protein expression in potato upon Rs infection. Therefore, the present study was carried out with the aim to identify Rs resistance genes and proteins from Rs resistance potato cultivar CT206-10 which could be used further to raise Rs resistance transgenic potato plants in future. For this, disease resistance assay and trypan blue staining were carried out to investigate the resistance in the Superior and CT206-10 cultivars. To analyze the Rs induced changes at the molecular level, these two cultivars were subjected to a proteomic analysis using a 2-DE-MS approach which were further validated by semi-quantitative RT-PCR.

Materials and Methods

Growth conditions of plant and Rs

Potatoes, superior and resistance cultivar CT206-10 (Kim-Lee et al., 2005), were propagated in sterile containers containing Murashige and Skoog, 1962 (MS) medium supplemented with 3% sucrose and 0.8% agar. The pH of the medium was adjusted to 5.8 prior to autoclaving. All cultures were maintained at 20 ± 1°C under 16 h light/8 h dark photoperiod. Seedlings were transferred to greenhouse after 4-5 weeks and allowed to grow in natural light condition. Rs strain KACC10722 (race 3, biovar 2) was grown on CPG medium (0.1% casamino acid, 1% peptone, 0.5% glucose, pH 6.5), cultured at 28°C for 24-48 h. The bacterial concentration was diluted to 107 cfu/ml prior to the plant infection.

Rs infection

For infiltration of pathogen Rs, the bacterial solutions at 107 cfu/ml in an approximately 1 ml volume, measured according to indicator syringes no needle, were infiltrated into potato leaves. Rs infection to roots was carried out as described earlier (Deslandes et al., 1998) with slight modifications. Approximately 2 cm of roots from the bottom of five to six weeks old potato seedling were cut and infected with Rs for 1 hr. The infected potato plants were then transferred to Jippy pots and bacterial wilt disease caused by Rs was observed for 14 days. Whole potato tissues from ten plants, each of superior and resistance cultivar CT206-10 were harvested after 7, 14 and 21 days of post-infection and stored at −80°C until used.

Trypan-blue staining

Trypan-blue staining was performed as described earlier (Peterhansel et al., 1997). In brief, potato leaves were boiled in trypan-blue solution [0.033% (w/v) trypan-blue, 8% (v/v) lactate, 8% (v/v) glycerol, 8% (v/v) phenol, 8% (v/v) water, and 67% (v/v) ethanol] until the green color disappeared. The leaves were then washed with water and transferred to the saturated chloral hydrate solution (2.5 mg/ml) to remove non-specific staining. The leaves were then immersed in the 50% (v/v) glycerol solution until analysis.

Protein preparation and 2-DE analysis

Total protein from ten grams of potato root was extracted using Mg/NP-40 extraction buffer [0.5 M Tris-HCl, pH 8.3; 2% v/v NP-40; 20 mM MgCl2; 2% v/v β-mercaptoethanol] followed by phenol extraction method as described earlier (Kim et al., 2001). Approximately, 600 μg protein was dissolved in the rehydration buffer [7 M (w/v) urea, 2 thiourea, 4% (w/v) CHAPS, 0.002% (w/v) bromophenol blue, 20 mM DTT, 0.5% (v/v) IPG buffer (pH 4-7)] and loaded on 24 cm IPG strips, pH 4-7 by rehydration loading overnight. First dimensional separation was carried out using following protocol: 50 V 4 h, 100 V 1 h, 500 V 1 h, 1,000 V 1 h, 2,000 V 1 h, 4,000 V 2 h, 8,000 V 5 h, and 8,000 V 9 h by IPGPhore2 platform (GE healthcare). Focused IPG strips were equilibrated using equilibration buffer containing 1% DTT as first step which was replaced by 2.5% iodoacetamide in the second step. Second dimensional separation was carried out using 12% SDS-PAGE after which the gels were stained with colloidal Coommassie brilliant blue G-250 (CBB).

MALDI-TOF/TOF MS identification of differential protein spots

Differential protein spots were excised from the 2D gels and were subjected to in-gel digestion as described previously (Kim et al., 2013). Prepared samples of tryptic peptides were subjected to MALDI-TOF/TOF MS using ABI 4800 Plus TOF-TOF Mass Spectrometer (Applied Biosystems, Framingham, MA, USA). The ten most and least intense ions per MALDI spot with signal/noise ratios >25 were selected for subsequent MS/MS analysis in 1 kV mode using 800-1,000 consecutive laser shots. Data were subjected to a Mass Standard Kit for the 4700 Proteomics Analyzer (calibration Mixture 1). MS/MS spectra were searched against the Uniprot/Swiss-Prot (14926175 sequences; 5299740401 residues) by Protein Pilot v.3.0 software (AB Sciex, Framingham, MA, USA) using MASCOT as search engine (ver. 2.3.0, Matrix Science, London, UK). The search parameters were as follows: fixed modifications-carbamidomethylation of cysteines, variable modification-methionine oxidation, peptide and fragment ion mass tolerances- 50 ppm, maximum trypsin missed cleavage- 1 and instrument type- MALDI-TOF/TOF. Only significant hits, as identified by the MASCOT probability analysis (p<0.05) were accepted.

Semi-quantitative RT-PCR

First-strand cDNA was synthesized from 1 μg of total RNA from the roots of CT206-10 potato cultivar infected with Rs in 20 μl of reaction mixture using Superscript III reverse transcriptase (Life Technologies, NY, USA). The semi-quantitative RT-PCR was performed using Actin and Tubulin genes as internal control. The PCR reaction conditions were initial denaturation at 94°C for 5 min, 22-35 cycles of 94°C for 30 s, 52-58°C for 30 s, 72°C for 30 s and then final extension at 72°C for 5 min. The PCR amplified products were electrophoresed on 1.5% agarose gel and transcript levels of genes were estimated.

Results and Discussion

Evaluation of potato cultivar CT206-10 against Rs infection

At first, we compared the resistance of “CT206-10” with that of wild type “superior” against Rs infection (Kim-Lee et al., 2005). Leaf wilting is one of the early symptoms of Rs infection in plants therefore; we observed the leaf wilting on both the cultivars after infection. Leaves of both the cultivars showed varied degree of wilting after infection with Rs, suggesting successful colonization of Rs in both the cultivars (Fig. 1). Although both the cultivars showed wilting of leaves, wilting percentage was far less in leaves of CT206-10 cultivar as compared to superior, suggesting increased resistance of former cultivar to Rs than later (Fig. 1). To further cross-check this observation, leaves of both the plants were subjected to trypan blue staining. Trypan blue staining is a measure of cell viability as it stains selectively the dead cells (Peterhansel et al., 1997). Results of trypan blue staining showed stronger blue color in the green leaves of superior plants in comparison with the CT206-10 leaves, indicating that cell death was weakly induced in CT206-10 cultivar (Fig. 2). Taken together, the results of disease resistance assay and trypan blue staining indicate that CT206-10 cultivar is relatively more resistant to Rs in comparison with the superior cultivar.

2-DE analysis of CT206-10 cultivar roots infected with Rs

Rs is a soil borne pathogen which invade susceptible plant through root. Therefore, proteins were extracted from the potato roots infected with Rs and used for 2-DE analysis. More than 500 reproducible spots were observed on the high-resolution 2-DE gels using Image Master 2D Platinum software (Fig. 3). Among these, 12 spots showed differential expression in Rs infected samples, of which 8 spots were identified by MALDI-TOF-MS (Table 1). The identified proteins were Actin 51 partial protein (Spot 2), Hypothetical protein of Oryza sativa Japonica group (Spot 4), Glycine-rich RNA binding protein (GRP; Spot 6), Tomato stress induced-1 protein (TSI-1; Spot 7), Hypothetical protein POPTR, Populus trichocarpa (Spot 8), Pathogenesis-related protein STH-2 (Spot 9), Putative pathogenesis protein (Spot 10) and Pentatricopeptide repeat containing protein (PPR; Spot 12).
In the present study, we observed that expression of glycine rich RNA binding protein in potato up-regulated upon Rs infection. Up-regulation of GRP in maize and carrot has also been reported in response to wounding and abscisic acid (ABA) (Gomez et al., 1988; Sturm, 1992). Homologs of glycine rich proteins were also found to be induced in response to cold in barley and Arabidopsis (Carpenter et al., 1994). The mutant plant of GRP7 (glycine rich protein 7) showed higher suceptibility for Pseudomonas syringae infection as compared to wild plant (Fu et al., 2007).
TSI-1 protein was found to up-regulated upon Rs infection. It belongs to intracellular pathogenesis related protein which is characterized in tomato, tobacco and pea during wounding, osmotic stress and pathogen colonization (Chiang and Hadwiger, 1990; Iturriaga et al., 1994; Vidya et al., 1999). TSI-1 protein also showed 71% homology with potato’s STH2 protein at nucleotide level (Vidya et al., 1999). This protein also has RNase activity against biotic stresses in some plants (Moiseyev et al., 1994).
Pathogenesis related protein (STH2, spot 9) was also found to be upregulated upon Rs infection. Similar result has also been reported earlier in potato in response to Phytophthora infestans infection (Constabel and Brisson, 1992). Homologs of STH2 gene have also been identified in different plants like pea, bean and parsley upon infection with different pathogens or elicitation (Chiang and Hadwiger, 1990; Somssich et al., 1988; Walter et al., 1990).
In contrast to the above mentioned proteins, the expression of PPR protein was down-regulated upon Rs infection. PPR protein is a RNA binding protein which control variety of post-transcriptional regulation like RNA editing, splicing, stability, polyadenylation and translation of organelle genes (Schmitz-Linneweber and Small, 2008; Tan et al., 2014). It was reported that WSL, a PPR protein targets to the chloroplast and wsl mutant plant showed defect in splicing of rpl2 transcript, resulted in transcript accumulation and reduction in its protein synthesis. The wsl mutant showed higher sensitivity to abiotic stresses like ABA, salinity and sugar (Tan et al., 2014). It has also been reported that in absence of PPR protein, Arabidopsis plant became susceptible to necrotrophic fungal pathogen and hypersensitive to abiotic stresses like ABA, glucose and salinity (Laluk et al., 2011).
Spot nos. 4 and 8 were identified as hypothetical proteins due to their unknown functions. Taken together, our results have shown up-regulation of both the proteins after Rs infection, suggesting their roles in plant defense. However, it needs further characterization of these identified proteins. Based on our observations and previous reports, it can be speculated that induction of these proteins under Rs infection may be involved in increasing Rs tolerance in potato.

Expression profiling of the corresponding genes regulated under Rs infection

MALDI-TOF-MS analysis identified eight differentially expressed proteins upon Rs infection, among them, five genes (StGRP, StTSI-1, StSTH-2, Hypothetical protein POPTR of Populus trichocarpa and StPPR) were selected to quantify their transcript levels by semi-quantitative RT-PCR. The present study identified up-regulation of all five genes after 7 days of Rs infection (Fig. 5). Interestingly, StTSI-1 was not expressed in control, whereas others were induced after Rs infection, suggesting it may play a role in defense response against Rs infection.
GRP protein expression increased 7 days after Rs infection and almost constant throughout all the investigated stages. The GRP transcript levels correspondingly upregulated after Rs infection. TSI-1, Hypothetical protein POPTR and STH-2 proteins were not detected in control plant but induced 7 days after Rs infection, and consistently decreased at later stages (7 to 21 days). Similar to the trend observed in TSI-1 protein, its transcripts were also not detected in control sample. However, the transcript levels of TSI-1 were increased consistently from 7 days to 21 days of post Rs-infection.
Overall, not 1:1 correlations were found in most of the examined transcripts level and their proteins level. This discrepancy can be due to various factors including post-transcriptional and post-translational modifications. Besides, functioning of some other regulatory mechanism cannot be neglected (Griffin et al., 2002; Gry et al., 2009; Velez-Bermudez and Schmidt, 2014).

Conclusion

R. solanacearum is one of the major pathogenic bacteria causing significant yield loss of potato. In the present study, we used an integrated proteomics and transcriptomics approach in order to find out the Rs responsive proteins in potato. Among the identified proteins, GRP, TSI-1, STH-2, hypothetical protein POPTR of Populus trichocarpa and PPR were further validated by semi-quantitative RT-PCR. Results of the present study showed that proteins regulated by Rs infection are also regulated at transcript level, suggesting roles of these proteins in resistance against Rs. Taken together, our results indicate the involvement of these 5 proteins in the Rs stress tolerance in potato. In the future, it would be interesting to raise the transgenic plants to further validate their involvement in resistance against Rs in potato.

Supplementary Information

Acknowledgments

This work was supported by a grant from the Agenda Program (PJ008574022014 and PJ010870022015), Rural Development Administration, Republic of Korea.

Fig. 1
Representative plants showing symptoms produced on wild type ‘Superior’ and resistant CT206-10 potato plants after 14 days of Rs (KACC10722) infection.
ppj-32-025f1.gif
Fig. 2
Trypan blue staining of leaves in Superior and CT206-10 after 3 or 4 days treatment with Rs. Superior potato leaves showed higher cell death as compared to CT206-10.
ppj-32-025f2.gif
Fig. 3
Representative 2-DE images of total root proteins of Rs infected the roots of CT206-10 potato cultivar after 0, 7, 14 and 21 days of inoculation. First dimension separation was carried out on 24 cm IPG strips, pH 4-7 and second dimension separation was carried out on 12% SDS-PAGE. Gels were stained with colloidal CBB stain. Differentially expressed protein spots are indicated by arrows.
ppj-32-025f3.gif
Fig. 4
Enlarged view of selected protein spots showing differential protein expression in 2-DE after Rs infection the roots of CT-206-10 potato cultivar.
ppj-32-025f4.gif
Fig. 5
Expression pattern of five different expressed genes in the roots of CT-206-10 potato cultivar after 0, 7 and 21 days of Rs infection by RT-PCR. GRP, Glycine-rich RNA binding protein; TSI-1, Tomato stress induced-1 protein TSI-1; STH-2, Pathogenesis-related protein; PPR, Pentatricopeptide repeat containing protein. The semi-quantitative RT-PCR was performed using Actin (StACT) and Tubulin (StTUB) genes as internal control.
ppj-32-025f5.gif
Table 1
Identification of differentially induced proteins in potato cultivar CT206-10 after Rs infection using MALDI-TOF/TOF MS
Spot Protein annotation Accession no. Mr/pI(T) Mr/pI(E) SC(%) Score Expect
2 Actin-51 partial protein of Solanum lycopersicum gi|3219772 37.3/5.3 67.4/6.0 57% 404 2.90E-35
4 Hypothetical protein OsJ_20312 [Oryza sativa Japonica Group] gi|222635062 78.2/9.0 78.2/9.0 40% 97 0.00014
6 Putative glycine-rich RNA binding protein-like [Solanum tuberosum] gi|82623423 17.6/5.6 17.6/5.6 59% 261 5.70E-21
7 TSI-1 protein [Solanum lycopersicum] gi|2887310 20.4/5.6 20.8/8.1 25% 152 4.60E-10
8 Hypothetical protein POPTR-0002s02160g (Populus trichocarpa) gi|224065795 28.2/9.9 18.0/8.2 32% 64 0.26
9 Pathogenesis-related protein STH-2 (Solanum tuberosum) gi|131026 17.4/5.7 18.4/9.3 52% 193 3.60E-14
10 Putative pathogenesis related protein [Capsicum chinense] gi|58531054 17.3/5.2 19.1/9.6 7% 70 0.072
12 Pentatricopeptide repeat containing protein [Arabidopsis thaliana] gi|22331104 69.7/8.5 70.2/4.3 21% 56 2

Mr/pI(T); Theological molecular weight and pI, Mr/pI(E); Experimental molecular weight and pI, SC; Sequence coverage

Table 2
Sequences of primers used for semi-quantitative RT-PCR
Gene name Accession number* Primer sequence (5′-3′)
StGRP (spot 6) DQ207875 Forward: ATGTTT TTTTGT TCA GATCTGCTTTGTTT
Reverse: CTAACT CCTCCAGTTTCCATCGGA
StTSI-1 (spot 7) NM_001247423 Forward: ATGGGTGTGAATACCTATACTTGTG
Reverse: TTAAGCGTAGGCAGAAGGATTCG
StPOTPR (spot 8) XM_006354748 Forward: GCAAAATTCACTGTACCCATTACT TCT
Reverse: GGACCCACAAAAGAATGGGACC
StSTH-2 (spot 9) M29041 Forward: ATGGGTGTCACTAGCTATACACATGAG
Reverse: TTAAGCGTAGACAGAAGGATTGGC
StPPR (spot 12) XM_006349566 Forward: ATGAATGGCGGCGACATGAAT
Reverse: CACCAGTGCTAAAGGCTGACCAA
StTUB Z33402 Forward: ATATCTCTAACAGTGCCAGAGCTTACTCA
Reverse: TCTGCAACCGGGTCATTCAT
StACT X55749 Forward: GCTTCCCGATGGTCAAGTCA
Reverse: TGGACGATGGACGGACCTG

* Accession numbers are from NCBI (www.ncbi.nlm.nih.gov/).

References

Ali, A, Alexandersson, E, Sandin, M, Resjo, S, Lenman, M, Hedley, P and Andreasson, E 2014. Quantitative proteomics and transcriptomics of potato in response to Phytophthora infestans in compatible and incompatible interactions. BMC Genomics. 15:497-514.
crossref pmid pmc pdf
Carpenter, CD, Kreps, JA and Simon, AE 1994. Genes encoding glycine-rich Arabidopsis thaliana proteins with RNA-binding motifs are influenced by cold treatment and an endogenous circadian rhythm. Plant Physiol. 104:1015-1025.
crossref pmid pmc
Champoiseau, PG, Jones, JB and Allen, C 2009. Ralstonia solanacearum race 3 biovar 2 causes tropical losses and temperate anxieties. Plant Health Prog. 10:1-10.
crossref
Chiang, CC and Hadwiger, LA 1990. Cloning and characterization of a disease resistance response gene in pea inducible by Fusarium solani. Mol Plant-Microbe Interact. 3:78-85.
crossref pmid
Constabel, CP and Brisson, N 1992. The defense-related STH-2 gene product of potato shows race-specific accumulation after inoculation with low concentrations of Phytophthora infestans zoospores. Planta. 188:289-295.
crossref pmid pdf
D’Ippolito, S, Terrile, MC, Godoy, AV, Casalongue, CA and Fiol, DF 2011. Identification and Expression of Stress-responsive Genes to Fusarium solani f. sp. eumartii Infection in Potato Tubers: Old and New Candidates. eds. by N Benkeblia, In: Potato V Food, 5:23-26.
Deslandes, L, Pileur, F, Liaubet, L, Camut, S, Can, C, Williams, K and Marco, Y 1998. Genetic characterization of RRS1, a recessive locus in Arabidopsis thaliana that confers resistance to the bacterial soilborne pathogen Ralstonia solanacearum. Mol Plant-Microbe Interact. 11:659-667.
crossref pmid
El-Komy, MH, Abou-Taleb, EM, Aboshosha, SM and El-Sherif, EM 2010. Differential expression of potato pathogenesis-related proteins upon infection with late blight pathogen: a case study expression of potato osmotin-like protein. Int J Agric Biol. 12:179-186.
Elphinstone, JG 2005. The current bacterial wilt situation: a global overview. eds. by C Allen, P Prior and AC Hayward, Bacterial wilt disease and the Ralstonia solanacearum species complex. In: Am Phytopathol Soc, 9-28.
Elphinstone, JG, Hennessey, J, Wilson, JK and Stead, DE 1996. Sensitivity of different methods for the detection of Ralstonia solanacearum in potato tuber extracts. EPPO Bulletin. 26:663-678.
crossref
Fu, ZQ, Guo, M, Jeong, BR, Tian, F, Elthon, TE, Cerny, RL and Alfano, JR 2007. A type III effector ADP-ribosylates RNA-binding proteins and quells plant immunity. Nature. 447:284-288.
crossref pmid pdf
Gomez, J, Sanchez-Martinez, D, Stiefel, V, Rigau, J, Puigdomenech, P and Pages, M 1988. A gene induced by the plant hormone abscisic acid in response to water stress encodes a glycine-rich protein. Nature. 334:262-264.
crossref pmid pdf
Griffin, TJ, Gygi, SP, Ideker, T, Rist, B, Eng, J, Hood, L and Aebersold, R 2002. Complementary profiling of gene expression at the transcriptome and proteome levels in Saccharomyces cerevisiae. Mol Cell Proteomics. 1:323-333.
crossref pmid
Gry, M, Rimini, R, Stromberg, S, Asplund, A, Ponten, F, Uhlen, M and Nilsson, P 2009. Correlations between RNA and protein expression profiles in 23 human cell lines. BMC Genomics. 10:365-378.
crossref pmid pmc pdf
Guevara, MG, Verissimo, P, Pires, E, Faro, C and Daleo, GR 2004. Potato aspartic proteases: induction, antimicrobial activity and substrate specificity. J Plant Pathol. 86:233-238.
Hayward, AC 1991. Biology and epidemiology of bacterial wil caused by Pseudomonas solanacernum. Annu Rev Phytopathol. 29:65-87.
crossref pmid
Iturriaga, EA, Leech, MJ, Barratt, DP and Wang, TL 1994. Two ABA-responsive proteins from pea (Pisum sativum L.) are closely related to intracellular pathogenesis-related proteins. Plant Mol Biol. 24:235-240.
crossref pmid pdf
Kim, SG, Wang, Y, Lee, KH, Park, ZY, Park, J, Wu, J and Kang, KY 2013. In-depth insight into in vivo apoplastic secretome of rice-Magnaporthe oryzae interaction. J Proteomics. 78:58-71.
crossref pmid
Kim, ST, Cho, KS, Jang, YS and Kang, KY 2001. Two-dimensional electrophoretic analysis of rice proteins by polyethylene glycol fractionation for protein arrays. Electrophoresis. 22:2103-2109.
crossref pmid
Kim-Lee, H, Moon, JS, Hong, YJ, Kim, MS and Cho, HM 2005. Bacterial wilt resistance in the progenies of the fusion hybrids between haploid of potato and Solanum commersonii. Am J Potato Res. 82:129-137.
crossref pdf
Kolomiets, MV, Chen, H, Gladon, RJ, Braun, EJ and Hannapel, DJ 2000. A leaf lipoxygenase of potato induced specifically by pathogen infection. Plant Physiol. 124:1121-1130.
crossref pmid pmc pdf
Laferriere, LT, Helgeson, JP and Allen, C 1999. Fertile Solanum tuberosum + S. commersonii somatic hybrids as sources of resistance to bacterial wilt caused by Ralstonia sotanacearum. Theor Appl Genet. 98:1272-1278.
crossref pdf
Laluk, K, AbuQamar, S and Mengiste, T 2011. The Arabidopsis mitochondria-localized pentatricopeptide repeat protein PGN functions in defense against necrotrophic fungi and abiotic stress tolerance. Plant Physiol. 156:2053-2068.
crossref pmid pmc pdf
Moiseyev, GP, Beintema, JJ, Fedoreyeva, LI and Yakovlev, GI 1994. High sequence similarity between a ribonuclease from ginsgeng calluses and fungus-elicited proteins from parsley indicates that intraeellular pathogenesis-related proteins are ribonucleases. Planta. 193:470-472.
pmid
Murashige, T and Skoog, F 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant. 15:473-497.
crossref
Peterhansel, C, Freialdenhoven, A, Kurth, J, Kolsch, R and Schulze-Lefert, P 1997. Interaction analyses of genes required for resistance responses to powdery mildew in barley reveal distinct pathways leading to leaf cell death. Plant Cell. 9:1397-1409.
crossref pmid pmc
Schmitz-Linneweber, C and Small, I 2008. Pentatricopeptide repeat proteins: a socket set for organelle gene expression. Trends Plant Sci. 13:663-670.
crossref pmid
Siddappa, S, Tiwari, JK, Sindhu, R, Sharma, S, Bhardwaj, V, Chakrabarti, SK and Singh, BP 2014. Phytophthora infestans associated global gene expression profile in a late blight resistant Indian potato cv. Kufri Girdhari Aus J Crop Sci. 8:215-222.
Somssich, IE, Schmelzer, E, Kawalleck, P and Hahlbrock, K 1988. Gene structure and in situ transcript localization of pathogenesis-related protein 1 in parsley. Mol Gen Genet. 213:93-98.
crossref pmid pdf
Sturm, A 1992. A wound-inducible glycine-rich protein from Daucus carota with homology to single-stranded nucleic acid-binding proteins. Plant Physiol. 99:1689-1692.
crossref pmid pmc
Tan, J, Tan, Z, Wu, F, Sheng, P, Heng, Y, Wang, X and Wan, J 2014. A novel chloroplast-localized pentatricopeptide repeat protein involved in splicing affects chloroplast development and abiotic stress response in rice. Mol Plant. 7:1329-1349.
crossref pmid
Taoutaou, A, Socaciu, C, Pamfil, D, Balazs, E, Botez, C, Chis, A and Matei, H 2011. Protein Expression in Some Susceptible Potato Late Blight Genotypes. Bulletin UASVM Agriculture. 68:363-367.
crossref pdf
Velez-Bermúdez, IC and Schmidt, W 2014. The conundrum of discordant protein and mRNA expression. Are plants special? Front Plant Sci. 5:619
crossref pmid pmc
Vidya, CS, Manoharan, M and Sita, GL 1999. Cloning and characterization of salicylic acid-induced intracellular pathogenesis-related gene from tomato (Lycopersicon esculentum). J Biosci. 24:287-293.
crossref pdf
Walter, MH, Liu, JW, Grand, C, Lamb, CJ and Hess, D 1990. Bean pathogenesis-related (PR) proteins deduced from elicitor-induced transcripts are members of a ubiquitous new class of conserved PR proteins including pollen allergens. Mol Gen Genet. 222:353-360.
crossref pmid pdf
Wenneker, M, Verdel, MSW, Groeneveld, RMW, Kempenaar, C, Van Beuningen, AR and Janse, JD 1999. Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in surface water and natural weed hosts: first report on stinging nettle (Urtica dioica). Eur J Plant Pathol. 105:307-315.
crossref pdf


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next