Plant Pathol J > Volume 37(2); 2021 > Article
Wang, Cui, Zhang, Ma, and Niu: Complete Genome Sequencing and Infectious cDNA Clone Construction of Soybean Mosaic Virus Isolated from Shanxi

Abstract

Soybean mosaic virus (SMV) is the predominant viral pathogen that affects the yield and quality of soybean. The natural host range for SMV is very narrow, and generally limited to Leguminosae. However, we found that SMV can naturally infect Pinellia ternata and Atractylodes macrocephala. In order to clarify the molecular mechanisms underlying the cross-family infection of SMV, we used double-stranded RNA extraction, rapid amplification of cDNA ends polymerase chain reaction and Gibson assembly techniques to carry out SMV full-length genome amplification from susceptible soybeans and constructed an infectious cDNA clone for SMV. The genome of the SMV Shanxi isolate (SMV-SX) consists of 9,587 nt and encodes a polyprotein consisting of 3,067 aa. SMV-SX and SMV-XFQ008 had the highest nucleotide and amino acid sequence identities of 97.03% and 98.50%, respectively. A phylogenetic tree indicated that SMV-SX and SMV-XFQ018 were clustered together, sharing the closest relationship. We then constructed a pSMV-SX infectious cDNA clone by Gibson assembly technology and used this clone to inoculate soybean and Ailanthus altissima; the symptoms of these hosts were similar to those caused by the virus isolated from natural infected plant tissue. This method of construction not only makes up for the time-consuming and laborious defect of traditional methods used to construct infectious cDNA clones, but also avoids the toxicity of the Potyvirus special sequence to Escherichia coli, thus providing a useful cloning strategy for the construction of infectious cDNA clones for other viruses and laying down a foundation for the further investigation of SMV cross-family infection mechanisms.

Soybean (Glycine max (L.) Merr) is an annual herbaceous plant of the Leguminosae soybean family and represents the world’s main oil crop. Soybean is also rich in soluble fibers, saponins, proteins, fats, and other nutrients that are beneficial to human growth and development. However, viral diseases have become an increasingly serious threat to soybean, causing enormous losses in both yield and quality. According to previous researches, more than 110 plant viruses in the United States are known to infect soybeans; in China over 50 viruses have been reported (Cui et al., 2018; Zhi, 2005). Of those, SMV is the predominant virus known to infect soybean. The range of natural hosts for SMV is particularly narrow and is generally limited to Leguminosae (Zheng et al., 2000; Zhou and Pu, 1990). However, over recent years, researchers have found that SMV can naturally infect Pinelliae ternata (Rohozková and Navrátil, 2011; Shentu, 2006; Shi, 2007; Sun et al., 2008). In a previous report, we described the isolation of SMV from susceptible P. ternata (SMV-SXBX), and phylogenetic tree showed that SMV-SXBX and SMV Pinellia isolates were clustered together, but far from SMV soybean isolates (Cui et al., 2018). In addition, we have also found that SMV can naturally infect Atractylodes macrocephala (Compositae) in China (data not published). However, the molecular mechanism of SMV cross-family infection is still unknown. As a technology, infectious cloning has been widely used in the study of pathogenicity of plant viruses. At present, we have successfully constructed the infectious cDNA clone of SMV-SXBX (Zhang et al., 2020), but it is not enough to clarify the molecular mechanisms underlying the cross-family infection of SMV. Therefore, this study is dedicated to construction of the infectious cDNA clone of SMV soybean isolate (SMV-SX).
Infectious clones for plant viruses refer to DNA clones that have been constructed artificially using molecular biology techniques and have the same infectious activity as plant viruses under natural conditions. The essence of these infectious clones is that they represent a DNA gene bank that contains the complete genome information of the virus (Boyer and Haenni, 1994). Normally, full-length cDNA clones for plant viruses are constructed using reverse genetics technology and subsequently used to explore RNA viruses at the DNA level, thus overcoming operational difficulties at the RNA level. The first successfully constructed infectious clone of an RNA virus was brome mosaic virus (BMV) (Ahlquist et al., 1984). Since then an increasing number of RNA viruses have been used to construct infectious clones, including cucumber mosaic virus (CMV) (Rizzo and Palukaitis, 1990), tomato aspermy cucumovirus (TAV) (Shi et al., 1997), beet mild yellowing virus (BMYV) (Stephan and Maiss, 2006), tomato yellow leaf curl sardinia virus (TYLCSV) (Kondo and Fujita, 2012), ribgrass mosaic virus (RMV) (Zhu et al., 2006), potato virus M (PVM) (Flatken et al., 2008), and pepper mottle virus (PMV) (Lee et al., 2011). However, the construction of infectious clones for Potyviruses is particularly challenging due to the presence of special viral sequences that have a toxic effect on Escherichia coli (Chikh Ali et al., 2011; Johansen and Lund, 2008); consequently, only a few reports have described the construction of such clones. The successful generation of infectious clones for Potyviruses has now been described for tobacco vein mottling virus (TVMV) (Domier et al., 1989; Nicolas et al., 1997), zucchini yellow mosaic virus (ZYMV) (Gal-On et al., 1991; Lin et al., 2002), tobacco etch virus (TEV) (Bedoya and Daròs, 2010; Dolja et al., 1992), peanut stripe virus (PStV) (Flasinski et al., 1996), potato virus A (PVA) (Puurand et al., 1996; Rajamäki and Valkonen, 2009), papaya ringspot virus (PRSV) (Chiang and Yeh, 1997), potato virus Y (PVY) (Chikh Ali et al., 2011; Jakab et al., 1997), turnip mosaic virus (TuMV) (Sánchez et al., 1998), johnsongrass mosaic virus (JGMV) (Kim et al., 2003), PMV (Lee et al., 2011), bean common mosaic virus (BCMV) (Naderpour and Johansen, 2011), and maize dwarf mosaic virus (MDMV) (Stewart et al., 2012). Although an infectious clone was successfully constructed for SMV in 1996 (Seo et al., 2009), the construction method was time-consuming and laborious.
In this study, we used Gibson assembly technology to rapidly construct an SMV-SX infectious clone in the form of a shuttle plasmid featuring both Escherichia coli and Agrobacterium recognition start sites. This method overcomes the limitations imposed by traditional construction methods that are time-consuming and labor-intensive, while also avoiding the toxicity of SMV special sequences to E. coli. We expect our findings to provide a reference for the construction of infectious clones for other viruses, and lay a foundation for further research relating to mechanisms of virus infection.

Materials and Methods

Materials

Fresh leaves from soybean plants that showed mosaic symptoms were collected from Jinzhong in Shanxi province in China in July 2018 and stored in liquid nitrogen for subsequent testing.

Extraction of double-stranded RNA and amplification of the SMV-SX genome

Total double-stranded RNA (dsRNA) of symptomatic soybean was extracted according to the method described previously by Krajacić et al. (2007), Li et al. (2007), and Tzanetakis and Martin (2008). Next, we generated first-strand cDNAs from dsRNA via reverse transcription polymerase chain reaction (RT-PCR) with moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) and an oligo(dT)18 primer at 42°C for 1 h and 70°C for 15 min. The complete viral genome was obtained through several RT-PCR amplifications and covering all gaps with virus-specific primers (Supplementary Table 1). The PCR conditions were set as described previously (Niu et al., 2018). We then performed rapid amplification of cDNA ends (RACE) PCR using a RACE kit (TaKaRa, Dalian, China) in accordance with the manufacturer’s recommendations. The PCR products were purified using an agarose gel DNA Gel Extraction kit (OMEGA, Guangzhou, China) in accordance with the manufacturer’s recommendations. The purified fragment was cloned directly into the pEASY-Blunt vector (TransGen, Beijing, China) and transformed into E. coli strain DH5α for Sanger sequencing.

Bioinformatics analysis of SMV-SX

The amplified sequences were spliced using SeqMan tool from the DNASTAR package (DNASTAR, Inc., Madison, WI, USA). Multiple sequence alignment was carried out for nucleotide and amino acid sequence using the optimal alignment tool in the DNAMAN software package (Lynnon, Biosoft, Canada). Phylogenetic tree performed by a maximum likelihood method with MEGA 7.1 software and ORF finder was used to predict the amino acid sequence encoded by nucleotides.

Construction of pSMV-SX via Gibson assembly

The full-length SMV-SX cDNA was divided into two overlapping amplified fragments using specific primers and ensuring that there was a 25-base-pair overlap (Table 1). A 35 S promoter and a CaMV polyA terminator were inserted into the multiple cloning sites of the binary pGreenII 0000 expression vector to generate pGreen-35S (Hellens et al., 2000). The pGreen-35S was amplified by primers with 25-33 bases that were homologous to the viral genome fragments. The PCR amplification reactions were performed with PrimeSTAR GXL DNA Polymerase (Takara). Amplicons of the expected sizes were purified with a DNA Gel Extraction kit (OMEGA). The viral genome fragments were then cloned into the linearized pGreen-35S vector by Gibson assembly (Tuo et al., 2017). The reaction was performed in a total volume of 10 μl, containing 150 ng of each purified PCR fragment and 5 μl of 2× Gibson Mix (NEB). The reaction mix was incubated at 50°C for 1 h, and then placed on ice prior to transformation into the Rhizobium radiobacter (synonym Agrobacterium tumefaciens).

Transformation of Agrobacterium tumefaciens and transfection

A reaction mix (5 μl) was transformed into 100 μl of Agrobacterium tumefaciens strain GV3101 (Weidi Biotech, Shanghai, China) competent cells (containing the pSoup helper plasmid) by electroporation according to a standard protocol. The transformants were then screened on Luria-Bertani (LB) medium containing 50 mg/l of kanamycin and 50 mg/l of rifampicin for 3 days at 28°C, and then screened by colony PCR using the primers shown in Supplementary Table 1. The plasmids (final 30 μl) were extracted from 80 ml culture of the positive colonies for sequencing.
Agroinfiltration was performed as previously described (Sparkes et al., 2006; Yan et al., 2012). A positive single colony of agrobacterium was picked from each infectious clone in order to inoculate 10 ml of LB medium supplemented with 50 mg/l of kanamycin and 50 mg/l of rifampicin. Bacteria were grown overnight at 28°C until they reached an OD600 of 1.0-1.5. The cultures were then pelleted and washed using infiltration buffer (10 mM MES pH 5.6, 10 mM MgCl2, and 100 μM a cetosyringone). Then, cells were diluted with infiltration buffer to a final OD600 of 0.6-0.8 and incubated for 3 h at room temperature in the dark prior to the agroinfiltration of soybean and A. altissima plants using 1 ml-syringes without a needle.
The plasmid inoculation approach was performed as previously described (Kang et al., 2016; Seo et al., 2009). Plasmid DNA of pSMV-SX was prepared using the Plasmid Maxi Kit (Qiagen, Shanghai, China). Approximately 50 μg plasmid DNA was diluted in 50 mM potassium phosphate, pH 7.5, to a total volume of 100 μl and inoculated onto two leaves per plant by direct rubinoculation with carborundum. All the inoculated plants were grown in a controlled environment with a 16 h light cycle at 28°C and then for 8 h in the dark at 25°C. After 45 days inoculation, the symptoms of inoculated plant leaves were photographed and further detected by RT-PCR technique.

RT-PCR

Total RNA was extracted from the upper non-inoculated leaves of the inoculated plants for RT-PCR using Tap DNA polymerase (TransGen) and a specific set of primers: SMV-CP-F and SMV-CP-R (Table 1). The PCR products were then transformed into E. coli DH5α for sequencing.

Results

Structure characteristics of the SMV-SX genome

First, dsRNA was extracted from diseased soybean leaves and reverse transcribed into cDNA to act as a template. We then used 11 pairs of specific primers and 2 pairs of RACE primers to amplify the entire SMV-SX genome. A series of fragments were produced, all of the expected sizes 820, 1,121, 776, 993, 1,141, 1,452, 1,037, 953, 1,027, 1,904, and 1,136 bp (Fig. 1). The SMV-SX genome consists of 9,587 nt and was determined by assembling the 13 amplified fragments using DNASTAR software.
The genomic organization of SMV-SX is typical for members of the Potyvirus genus and is consistent with that of other SMV sequences, with a large open reading frame (ORF) encoding a putative polyprotein of 3,067 amino acids. The ORF begins at nt position 133 and ends with a stop codon at position 9332-9335. The 5′ and 3′ untranslated regions consist of 132 and 252 nt, respectively. The polyprotein has nine putative cleavage sites and can be cleaved into ten mature proteins (P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa, NIb, and CP). The cleavage site in the P1/ HC-Pro dipeptide is predicted to be cleaved by the P1 serine proteinase, whereas the cleavage site in the HC-Pro/P3 is cleaved by the HC-Pro cysteine proteinase. In addition, the cleavage sites of the seven other dipeptides are cleaved by the NIa-Pro cysteine proteinase. The predicted cleavage sites are as follows: IQHY309/S (P1/HC-Pro), YRVG766/ G (HC-Pro/P3), VSAQ1113/A (P3/6K1), VKVQ1165/S (6K1/CI), VQLQ1799/S (CI/6K2), VSTQ1852/G (6K2/ NIa-VPg), VEME2042/S (NIa-VPg/NIaPro), VTVQ 2285/ G (NIa-Pro/NIb), and VSLQ2802/S (NIb/CP) (Fig. 2).

SMV-SX sequence similarity

The homology and similarity of SMV-SX with other SMV isolates were analyzed using DNAMAN software and showed that the nucleotide and amino acid identities were 75.19-97.03% and 81.70-98.50%, respectively (Table 2). SMV-SX had the highest identity to SMV-XFQ008 from China. The identities of the nucleotide and amino acid sequences were 97.03% and 98.50%, respectively. Phylogenetic analysis also showed that the SMV-SX isolate clustered with SMV-XFQ008 (Fig. 3).

Construction of a pSMV-SX plasmid by Gibson assembly

Using the 3′-RACE reverse transcription product of the soybean dsRNA as a template, we used two large pairs of specific primers (SMV-F1/SMV-R3716 and SMV-F3697/ SMV-R1) (Table 1) to amplify fragments of 3,738 bp and 5,894 bp, respectively. Using the pGreen-35S plasmid as a template, and using specific primers (pGr35S-smvF/ pGr35S-R), we then obtained the target band of 3,233 bp by reverse PCR (Fig. 4A-C). Gibson assembly technology was then used to ligate the two SMV fragments into the linearized pGreen-35S vector. The recombination vector was subsequently electroporated into Agrobacterium GV3101 (pSoup) competent cells. Positive clones were then identified by colony PCR using specific primers SMV-F6 and SMV-R6 (Fig. 4D, Supplementary Table 1) and plasmid extraction (Fig. 4E).

Activity analysis of the infectious pSMV-SX clone

Agrobacterium infiltration and plasmid inoculation were used to inoculate soybean varieties (Kefeng No. 1 and 1138-2 at the 3-4 leaf stage) and A. altissima. After 45 days, the inoculated plants all showed symptoms of susceptibility (Fig. 5D-F). We then extracted RNA from the symptomatic leaves of all plants and used this as a template for RT-PCR using SMV-CP-F and SMV-CP-R primers, the electrophoresis and sequencing results showed that the constructed SMV-SX infectious clone had infectious activity (Fig. 5G-I).

Discussion

Plant viruses have caused a range of serious diseases in a wide variety of plants, thus causing global economic losses of up to 30 billion dollars annually (Sastry and Zitter, 2014). More than 90% of viral nucleic acids in plants are single-stranded RNA, and dsRNA is produced when replicated (Zhou and Li, 1995). The principle that dsRNA can be specifically adsorbed by cellulose CF-11 at a certain concentration of alcohol can be used to identify plant viruses (Tian and Wang, 1995). dsRNA technology overcomes the limitations associated with the use of single-stranded RNA in traditional RT-PCR, is stable during extraction, and is not affected by polyphenols and polysaccharides. This technology is not only simple and convenient to operate, but can also detect known, unknown, and low concentration viruses. In addition, the combination of dsRNA and sequence-independent amplification technology can achieve the purpose of detecting multiple viruses simultaneously (Kou et al., 2017). Niu et al. (2003), Wang et al. (2016), and Yang et al. (2017), all used this technology to detect pear vein yellow virus (PVYV), youcai mosaic virus (YoMV), and malva vein clearing virus (MVCV).
Techniques to clone infectious plant viruses have been applied to many aspects of plant virus research. First, those techniques have been used to investigate the molecular biology of viruses; Galiakparov et al. (2003) used infectious cloning techniques to investigate the proteins encoded by the five ORFs of grapevine virus A (GVA). Second, those techniques have been used to investigate viral pathogenic factors; Chiang et al. (2007) used infectious cloning technology to show that three amino acids in the P1 and HC-Pro regions of PRSV are closely related to the pathogenicity of the virus. Third, this technology has been used to construct plant expression vectors (Chapman et al., 1992) and gene silencing vectors (Liu and Lomonossoff, 2002). Fourth, these techniques have been used to develop attenuated strains. By using reverse genetics to make site-directed mutations of infectious clones, it was possible to obtain attenuated strains, thus achieving cross-protection (Chiang et al., 2007).
However, studies have shown that there are special sequences in the Potyvirus that can cause varying degrees of toxicity to E. coli (Chikh Ali et al., 2011; Johansen and Lund, 2008). However, the specific mechanism underlying these effects has yet to be identified. This makes the construction of infectious clones of SMV more difficult. In the current study, Gibson assembly technology was used to rapidly construct an infectious SMV clone shuttle plasmid. This construction overcomes the time-consuming and laborious nature of the traditional method used to construct infectious clones, and also avoided the toxicity of SMV infectious clones to E. coli. To our knowledge, this study represents the first construction of a full-length infectious cDNA of SMV that is capable of infecting soybean and Altissima by using Gibson assembly technology. The agroinfectious clone described herein can therefore be useful for further studies of plant-virus interaction and the characterization of viral genes. Our findings also lay down the foundation for studying the mechanisms associated with cross-family SMV infection.
SMV only has a very narrow range of hosts, and generally only infects Leguminosae. Over recent years, our laboratory has found that SMV can infect P. ternata (Araceae) and A. atractylodes (Compositae), although the mechanism underlying cross-family infection remains unclear. Sequence comparison revealed that there was a significant difference between the P1 protein of a SMV-P. ternata isolate and a SMV soybean isolate (data not published). Other researches have suggested that this non-conservative protein plays a key role in the successful adaptation of Potyviruses into a wide range of host species (Rohožkoá and Navrátil, 2011; Valli et al., 2007). At present, our laboratory is conducting further research on P1 protein to investigate its impact on cross-family SMV infection. Based on our previously constructed infectious clone of SMV-P. ternate isolate (Zhang et al., 2020) and this study constructed infectious clone of SMV soybean isolate, the molecular mechanism of SMV cross-family infection was to clarify by exchanging the P1 protein and other differential proteins.

Notes

Handling Editor: Ho-Jong Ju

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This study was supported by National Natural Science Foundation of China (No. 31772130), China Agriculture Research System (Grant No. CARS-21) and Modern Agroindustry Technology Research System (No. 2020-05). Authors also thank to Dr Tuo Decai and Dr Niu Jingping for providing the vector pGreen-35S and soybean seeds. The authors would like to express their gratitude to EditSprings (https://www.editsprings.com/) for the expert linguistic services provided.

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).
Supplementary Table 1.
Primer pairs used to amplify the SMV-SX whole genome
PPJ-OA-11-2020-0209-suppl1.pdf

Fig. 1
Image of agarose gel electrophoresis of reverse transcription polymerase chain reaction products from the SMV-SX genome. (A-K) Primer set SMV-F1-11 + SMV-R1-11: lanes 1-3, infected plants; CK, healthy plants; M, DL 2000TM DNA marker. (L) 5′ RACE: lanes 1-3, the 5′ proximal end length; CK, healthy plants; M, DL 2000TM DNA marker. (M) 3′ RACE: lanes 1-3, the 3′ proximal end length; CK, healthy plants; M, DL 2000TM DNA marker. SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate.
PPJ-OA-11-2020-0209f1.jpg
Fig. 2
Images showing the organization of the SMV-SX genome. Open reading frames are represented by boxes while the numbers under the boxes represent the nucleotide position. The uppercase letters above the boxes indicate predicted cleavage sites. SMV-SX, soybean mosaic virus Shanxi isolate.
PPJ-OA-11-2020-0209f2.jpg
Fig. 3
Phylogenetic tree based on the nucleotide sequences of SMV-SX and other SMV isolates. Phylogenetic tree was constructed by the maximum likelihood method with 1,000 bootstrap replicates. SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate.
PPJ-OA-11-2020-0209f3.jpg
Fig. 4
Image of agarose gel electrophoresis of reverse transcription polymerase chain reaction products from SMV-SX infectious clones. (A) PCR product from pGr35S-smvF/pGr35S-R. (B) PCR product from SMV-F1/SMV-R3716. (C) PCR product from SMV-F3697/ SMV-R1. (D) PCR product from colony PCR using specific primers SMV-F6 and SMV-R6. (E) The recombination vector plasmid extraction result. M1, DL 5000 DNA marker; M2, DL 10000 DNA marker; M3, DL 2000 DNA marker; M4, DL 15000 DNA marker; lanes 1-3, infected plant; CK, healthy plant. SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate.
PPJ-OA-11-2020-0209f4.jpg
Fig. 5
Plants inoculated with the infectious SMV-SX clone all showed symptoms and reverse transcription polymerase chain reaction detection. (A) Normal Ailanthus altissima plant. (B) Normal soybean 1138-2 plant. (C) Normal soybean Kefeng No. 1 plant. (D) Susceptible A. altissima plant showing mosaic symptoms. (E) Susceptible soybean 1138-2 plant showing mosaic symptoms. (F) Susceptible soybean Kefeng No. 1 showing mosaic symptoms. (G) Amplification results from the SMV-CP primer in A. altissima. (H) Amplification results from the SMV-CP primer in soybean 1138-2. (I) Amplification results from SMV-CP primer in soybean of Kefeng No. 1. SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate. M, DL 2000 DNA marker; lanes 1-3, inoculated plants; CK, non-inoculated plant.
PPJ-OA-11-2020-0209f5.jpg
Table 1
Primer pairs for creating SMV-SX infectious cDNA clones
Primer name Primer sequence (5′-3′) Description
pGr35S-smvF CCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAA
TCGGTACGCTGAAATCACCAGTCTC
For vector of SMV
pGr35S-R CCTCTCCAAATGAAATGAACTTCCT
SMV-F1 AGGAAGTTCATTTCATTTGGAGAGG
AAATTAAAACTAGTTATAAA GACAGCAAACAAATTAAAC
For SMV fragment 1
SMV-R3716 AGAGACGCTGGAAGACTCCTTATTTG
SMV-F3697 AGGAGTCTTCCAGCGTCTCTTTTGA For SMV fragment 2
SMV-R1 CGATTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTT
AGGACAACAAACATTGCCGTA
SMV-CP-F TTACAATCAGGCAAGGAGAAGGAA For RT-PCR detection
SMV-CP-R GGGTCAAAACCACACTAAACAAAAG

The sequence marked with a horizontal line represents a homologous sequence.

SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate; RT-PCR, reverse transcription polymerase chain reaction.

Table 2
A comparison of nucleotide and amino acid sequence homology between SMV-SX and other SMV isolates
Isolate GenBank accession no. Host Location Nucleotide sequence identities (%) Amino sequence identities (%)
Aa15-M2 AB100443 Soybean Japan 92.97 96.84
CN18 AJ619757 Soybean South Korea 92.11 95.63
G7 AY216010 Soybean USA 92.57 96.54
G5 AY294044 Soybean South Korea 94.41 97.52
G7H AY294045 Soybean South Korea 94.85 97.78
L EU871724 Soybean Canada 95.31 97.91
WS200 FJ548849 Wild soybean South Korea 94.86 97.65
WS105 FJ640958 Wild soybean South Korea 92.92 96.77
WS117 FJ640962 Wild soybean South Korea 93.66 96.97
WS128 FJ640963 Wild soybean South Korea 95.00 97.65
WS155 FJ640970 Wild soybean South Korea 92.64 96.61
WS156 FJ640971 Wild soybean South Korea 92.89 96.80
WS160 FJ640972 Wild soybean South Korea 95.09 97.55
G1 FJ640977 Soybean South Korea 93.71 97.26
413 GU015011 Soybean USA 93.65 97.39
4547/CHN/2004 HQ396725 Soybean China 87.03 90.76
SC3 JF833013 Soybean China 93.42 96.90
Lo3 KF135490 Soybean Iran 94.82 97.95
Go11 KF135491 Soybean Iran 94.70 97.82
Ar33 KF297335 Soybean Iran 94.82 97.98
India KM979229 Soybean India 94.40 97.46
SC7-N KP710868 Soybean China 87.40 90.76
XFQ008 KP710873 Soybean China 97.03 98.50
XFQ010 KP710874 Soybean China 94.90 98.08
XFQ018 KP710877 Soybean China 93.19 97.16
JAAS-6 KR024718 Soybean China 88.10 89.50
HB-RS KR065437 Soybean China 87.68 90.51
China KX096578 Soybean China 93.15 97.49
SC001 KX834320 Soybean China 88.11 90.85
JSJJ001 KX834321 Soybean China 87.90 90.94
HLJBADS001 KX834324 Soybean China 94.73 96.58
HLJHLQF001 KX834325 Soybean China 92.49 96.94
CC2515 KY986929 Vigna angularis South Korea 95.30 97.72
N NC_002634 Soybean USA 95.18 97.72
Severe strain AJ312439 Soybean China 93.23 81.93
HZ1 AJ628750 Pinellia ternata China 78.65 83.54
NN KF982784 Pinellia pedatisecta China 78.03 83.80
Am KC845322 Atractylodes macrocephala China 75.19 81.70
SC001 KX834320 Soybean China 88.11 90.85
G2 S42280.1 Soybean USA 94.92 97.03
SXBX MT712111 Pinellia ternata China 76.12 82.53

SMV, soybean mosaic virus; SMV-SX, SMV Shanxi isolate.

References

Ahlquist, P., French, R., Janda, M. and Loesch-Fries, L. S. 1984. Multicomponent RNA plant virus infection derived from cloned viral cDNA. Proc. Natl. Acad. Sci. U. S. A. 81:7066-7070.
crossref pmid pmc
Bedoya, L. C. and Daròs, J. A. 2010. Stability of tobacco etch virus infectious clones in plasmid vectors. Virus Res. 149:234-240.
crossref pmid
Boyer, J. C. and Haenni, A. L. 1994. Infectious transcripts and cDNA clones of RNA viruses. Virology. 198:415-426.
crossref pmid
Chapman, S., Kavanagh, T. and Baulcombe, D. 1992. Potato virus X as a vector for gene expression in plants. Plant J. 2:549-557.
crossref pmid
Chiang, C.-H., Lee, C.-Y., Wang, C.-H., Jan, F.-J., Lin, S.-S., Chen, T.-C., Raja, J. A. J. and Yeh, S.-D. 2007. Genetic analysis of an attenuated papaya ringspot virus strain applied for cross-protection. Eur. J. Plant Pathol. 118:333-348.
crossref
Chiang, C.-H. and Yeh, S.-D. 1997. Infectivity assays of in vitro and in vivo transcripts of papaya ringspot potyvirus. Bot. Bull. Acad. Sin. 38:153-163.
Chikh Ali, M., Said Omar, A. and Natsuaki, T. 2011. An infectious full-length cDNA clone of potato virus YNTN-NW, a recently reported strain of PVY that causes potato tuber necrotic ringspot disease. Arch. Virol. 156:2039-2043.
crossref pmid
Cui, L.-Y., Pang, X.-J., Qi, Y.-H., Wang, B.-X., Wang, D.-F. and Niu, Y.-B. 2018 Identification of the pathogens of Pinellia ternata virus by small RNA deep sequencing. Chin. J. Biochem. Mol. Biol. 34:1334-1341 (in Chinese).
Dolja, V. V., McBride, H. J. and Carrington, J. C. 1992. Tagging of plant potyvirus replication and movement by insertion of β-glucuronidase into the viral polyprotein. Proc. Natl. Acad. Sci. U. S. A. 89:10208-10212.
crossref pmid pmc
Domier, L. L., Franklin, K. M., Hunt, A. G., Rhoads, R. E. and Shaw, J. G. 1989. Infectious in vitro transcripts from cloned cDNA of a potyvirus, tobacco vein mottling virus. Proc. Natl. Acad. Sci. U. S. A. 86:3509-3513.
crossref pmid pmc
Flasinski, S., Gunasinghe, U. B., Gonzales, R. A. and Cassidy, B. G. 1996. The cDNA sequence and infectious transcripts of peanut stripe virus. Gene. 171:299-300.
crossref pmid
Flatken, S., Ungewickell, V., Menzel, W. and Maiss, E. 2008. Construction of an infectious full-length cDNA clone of potato virus M. Arch. Virol. 153:1385-1389.
crossref pmid
Galiakparov, N., Tanne, E., Sela, I. and Gafny, R. 2003. Functional analysis of the grapevine virus A genome. Virology. 306:42-50.
crossref pmid
Gal-On, A., Antignus, Y., Rosner, A. and Raccah, B. 1991. Infectious in vitro RNA transcripts derived from cloned cDNA of the cucurbit potyvirus, zucchini yellow mosaic virus. J. Gen. Virol. 72:2639-2643.
crossref pmid
Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S. and Mullineaux, P. M. 2000. pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol. 42:819-832.
pmid
Jakab, G., Droz, E., Brigneti, G., Baulcombe, D. and Malnoë, P. 1997. Infectious in vivo and in vitro transcripts from a fulllength cDNA clone of PVY-N605, a Swiss necrotic isolate of potato virus Y. J. Gen. Virol. 78:3141-3145.
crossref pmid
Johansen, I. E. and Lund, O. S. 2008. Insertion of introns: a strategy to facilitate assembly of infectious full length clones. Methods Mol Biol. 451:535-544.
crossref pmid pmc
Kang, M., Seo, J.-K., Choi, H., Choi, H.-S. and Kim, K.-H. 2016. Establishment of a simple and rapid gene delivery system for cucurbits by using engineered of Zucchini yellow mosaic virus. Plant Pathol J. 32:70-76.
crossref pmid pmc
Kim, K.-S., Oh, H.-Y., Suranto, S., Nurhayati, E., Gough, K. H., Shukla, D. D. and Pallaghy, C. K. 2003. Infectivity of in vitro transcripts of Johnsongrass mosaic potyvirus full-length cDNA clones in maize and sorghum. Arch. Virol. 148:563-574.
crossref pmid
Kondo, T. and Fujita, T. 2012. Complete nucleotide sequence and construction of an infectious clone of Chinese yam necrotic mosaic virus suggest that macluraviruses have the smallest genome among members of the family Potyviridae. Arch. Virol. 157:2299-2307.
crossref pmid
Kou, L., Zhao, H., Wang, D., Guo, S. and Niu, Y. 2017 Molecular identification of pathogens infecting Bupleurum chinese. Chin J Virol. 33:610-616 (in Chinese).
Krajacić, M., Ivancic-Jelecki, J., Forcic, D., Vrdoljak, A. and Skorić, D. 2007. Purification of plant viral and satellite double-stranded RNAs on DEAE monoliths. J. Chromatogr A. 1144:111-119.
crossref pmid
Lee, M. Y., Song, Y. S. and Ryu, K. H. 2011. Development of infectious transcripts from full-length and GFP-tagged cDNA clones of pepper mottle virus and stable systemic expression of GFP in tobacco and pepper. Virus Res. 155:487-494.
crossref pmid
Li, H., Dai, H.-Y., Zhang, Z.-H., Gao, X.-Y., Du, G.-D. and Zhang, X.-Y. 2007. Isolation and identification of virus dsRNA from strawberry plants. Agric Sci China. 6:86-93.
crossref
Lin, S.-S., Hou, R. F. and Yeh, S.-D. 2002. Construction of in vitro and in vivo infectious transcripts of a Taiwan strain of zucchini yellow mosaic virus. Bot. Bull. Acad. Sin. 43:261-269.
Liu, L. and Lomonossoff, G. 2002. Agroinfection as a rapid method for propagating cowpea mosaic virus-based constructs. J. Virol. Methods. 105:343-348.
crossref pmid
Naderpour, M. and Johansen, I. E. 2011. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of bean common mosaic virus. Virus Res. 159:1-8.
crossref pmid
Nicolas, O., Dunnington, S. W., Gotow, L. F., Pirone, T. P. and Hellmann, G. M. 1997. Variations in the VPg protein allow a potyvirus to overcome va gene resistance in tobacco. Virology. 237:452-459.
crossref pmid
Niu, J. X., Liu, L. K., Zhu, J. and Zuo, W. M. 2003 Study on the RT-PCR detection system for pear vein yellow virus by using dsRNA as template. J. Fruit Sci. 20:143-145 (in Chinese).
Niu, Y., Pang, X., Wang, D., Guo, S. and Liu, Y. 2018. Deep sequencing analysis of a strain of pecan mosaic-associated virus infecting Atractylodes macrocephala Koidz. J. Plant Pathol. 100:249-255.
crossref
Puurand, U., Valkonen, J. P. T., Mäkinen, K., Rabenstein, F. and Saarma, M. 1996. Infectious in vitro transcripts from cloned cDNA of the potato A potyvirus. Virus Res. 40:135-140.
crossref pmid
Rajamäki, M.-L. and Valkonen, J. P. T. 2009. Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-like potato virus A in Nicotiana species. Plant Cell. 21:2485-2502.
crossref pmid pmc pdf
Rizzo, T. M. and Palukaitis, P. 1990. Construction of full-length cDNA clones of cucumber mosaic virus RNAs 1, 2 and 3: generation of infectious RNA transcripts. Mol Gen Genet. 222:249-256.
crossref pmid
Rohozková, J. and Navrátil, M. 2011. P1 peptidase-a mysterious protein of family Potyviridae. J. Biosci. 36:189-200.
crossref pmid pdf
Sánchez, F., Martínez-Herrera, D., Aguilar, I. and Ponz, F. 1998. Infectivity of turnip mosaic potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana and local lesion hosts. Virus Res. 55:207-219.
crossref pmid
Sastry, K. S. and Zitter, T. A. 2014. Plant virus and viroid diseases in the tropics. Vol. 2. Epidemiology and management. Springer, The Netherlands. 489.
Seo, J.-K., Lee, H.-G. and Kim, K.-H. 2009. Systemic gene delivery into soybean by simple rub-inoculation with plasmid DNA of a soybean mosaic virus-based vector. Arch. Virol. 154:87-99.
crossref pmid
Shentu, S. S. 2006. Detection of viruses infecting Pinellia ternata (Thunb.) Breit and phylogenetic study on soybean mosaic virus. MS thesis. Zhejiang University, Zhejiang, China. (in Chinese).
Shi, B.-J., Ding, S.-W. and Symons, R. H. 1997. Plasmid vector for cloning infectious cDNAs from plant RNA viruses: high infectivity of cDNA clones of tomato aspermy cucumovirus. J. Gen. Virol. 78:1181-1185.
crossref pmid
Shi, Y. H. 2007. Molecular characterization of potyviruses infecting aroid plants for medicinal use in China. PhD thesis. Zhejiang University, Zhejiang, China. (in Chinese).
Sparkes, I. A., Runions, J., Kearns, A. and Hawes, C. 2006. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc. 1:2019-2025.
crossref pmid
Stephan, D. and Maiss, E. 2006. Biological properties of beet mild yellowing virus derived from a full-length cDNA clone. J. Gen. Virol. 87:445-449.
crossref pmid
Stewart, L. R., Bouchard, R., Redinbaugh, M. G. and Meulia, T. 2012. Complete sequence and development of a full-length infectious clone of an Ohio isolate of maize dwarf mosaic virus (MDMV). Virus Res. 165:219-224.
crossref pmid
Sun, H., ShenTu, S., Xue, F., Duns, G. and Chen, J. 2008. Molecular characterization and evolutionary analysis of soybean mosaic virus infecting Pinellia ternata in China. Virus Genes. 36:177-190.
crossref pmid
Tian, W. H. and Wang, J. Z. 1995 Applications dsRNA analysis to the detection of RNA viruses. J. Hebei Agric Univ. 18:112-117 (in Chinese).
Tuo, D., Fu, L., Shen, W., Li, X., Zhou, P. and Yan, P. 2017. Generation of stable infectious clones of plant viruses by using Rhizobium radiobacter for both cloning and inoculation. Virology. 510:99-103.
crossref pmid pmc
Tzanetakis, I. E. and Martin, R. R. 2008. A new method for extraction of double-stranded RNA from plants. J. Virol. Methods. 149:167-170.
crossref pmid
Valli, A., López-Moya, J. J. and García, J. A. 2007. Recombination and gene duplication in the evolutionary diversification of P1 proteins in the family Potyviridae. J. Gen. Virol. 88:1016-1028.
crossref pmid
Wang, D.-F., Zhang, X.-M., Yang, F. and Niu, Y.-B. 2016 Identification and analysis of complete genomic sequence of Youcai mosaic virus Rehmannia glutinosa isolate in Shanxi. Acta Phytopathol Sin. 46:598-604 (in Chinese).
Yan, P., Shen, W., Gao, X., Li, X., Zhou, P. and Duan, J. 2012. High-throughput construction of intron-containing hairpin RNA vectors for RNAi in plants. PLoS ONE. 7:e38186.
crossref pmid pmc
Yang, F., Niu, E.-B., Wang, D.-F. and Niu, Y.-B. 2017 Sequence analysis of cp gene of Malva vein clearing virus Althaea rosea isolates in China. Acta Phytopathol Sin. 47:458-462 (in Chinese).
Zhang, L., Wang, D., Pei, Y., Xian, S. and Niu, Y. 2020 Construction and characterization of an infectious clone of Soybean mosaic virus isolate from Pinellia ternata. Chin J Biotechnol. 36:949-958 (in Chinese).
Zheng, C.-M., Chang, R.-Z. and Qiu, L.-J. 2000 Progress on the disease of soybean mosaic virus. Acta Phytopathol Sin. 30:97-105 (in Chinese).
Zhi, H. J. 2005. Evaluation, inheritance and utilization of resistance in infection and resistance in development to Soybean mosaic virus. PhD thesis. Nanjing Agricultural University, Nanjing, China. (in Chinese).
Zhou, X. P. and Li, D. B. 1995. Application of double-stranded RNA technology in the study of plant viruses. Biotechnology. 1:1-4.
Zhou, X. and Pu, Z. 1990 Natural infection of pisum sativum by soybean mosaic virus in Nanjing. J. Nanjing Agric Univ. 13:53-56 (in Chinese).
Zhu, H. Q., Chen, J. P. and Yu, S. Q. 2006. Construction of an infectious cDNA clone of ribgrass mosaic virus Shanghai isolate and its modification to express an epitope of Mycobacterium tuberculosis. Arch. Virol. 151:1853-1861.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2024 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next