Plant Pathol J > Volume 32(2); 2016 > Article
Mang, Frisullo, Elshafie, and Camele: Diversity Evaluation of Xylella fastidiosa from Infected Olive Trees in Apulia (Southern Italy)

Abstract

Olive culture is very important in the Mediterranean Basin. A severe outbreak of Olive Quick Decline Syndrome (OQDS) caused by Xylella fastidiosa infection was first noticed in 2013 on olive trees in the southern part of Apulia region (Lecce province, southern Italy). Studies were carried out for detection and diversity evaluation of the Apulian strain of Xylella fastidiosa. The presence of the pathogen in olive samples was detected by PCR amplifying the 16S rDNA, gyrase B subunit (gyrB) and HL hypothetical protein genes and single nucleotide polymorphisms (SNPs) assessment was performed to genotype X. fastidiosa. Twelve SNPs were recorded over gyrB and six SNPs were found for HL gene. Less variations were detected on 16S rDNA gene. Only gyrB and HL provided sufficient information for dividing the Apulian X. fastidiosa olive strains into subspecies. Using HL nucleotide sequences was possible to separate X. fastidiosa into subspecies pauca and fastidiosa. Whereas, nucleotide variation present on gyrB gene allowed separation of X. fastidiosa subsp. pauca from the other subspecies multiplex and fastidiosa. The X. fastidiosa strain from Apulia region was included into the subspecies pauca based on three genes phylogenetic analyses.

Introduction

Olive (Olea europea L.) trees in 2007 have been cultivated worldwide over an area greater than 10 million hectares (IOC, 2009). The culture is primarily diffused in the Mediterranean Basin. Countries outside this area account for about 25% of the acreage but for only 10% of the entire production (Cimato and Attillio, 2011). Nowadays, Italian olive cultivation covers almost 2 million hectares, 80% of which are mostly located in southern Italy (Fontanazza, 2005). Recently, olive has been found infected by the Xylella fastidiosa Wells and Raju (1987) bacterium (Saponari et al., 2013) that caused the death of thousands of olive trees in Apulia (southern Italy). Xylella fastidiosa (Xf ) is a quarantine pathogen included in EPPO A 1 list, xylem-limited, Gram-negative bacterium that causes economically important plant diseases. More than 200 plant species are colonized by Xf including grapevine, coffee, citrus, almond, peach, plum, alfalfa, maple, olive, mulberry and also ornamentals such as oleander, sycamore, elm, oak and many other plants (Hopkins, 1989; Purcell and Hopkins, 1996; Simpson et al., 2000; Janse and Obradovic, 2010). It grows in the xylem of the hosts causing a wide variety of diseases such as Pierce’s Disease (PD) in grapevine, Citrus Variegated Chlorosis (CVC) in citrus, leaf scorch diseases in a broad range of plants including almond, coffee, sycamore, oleander, elm, pecan, pear, mulberry, maple and oak and other diseases of crops, ornamentals and woody plants (Hopkins and Purcell, 2002; Janse and Obradovic, 2010; Purcell, 2013). So far, four subspecies of the bacterium are known: fastidiosa, multiplex, pauca and sandyi (Schaad et al., 2004; Schuenzel et al., 2005; Randall et al., 2009). Xf subsp. fastidiosa comprises strains from grape, alfalfa and maple; Xf subsp. multiplex includes strains from plum, peach, elm, almond and sycamore; Xf subsp. pauca contains strains from citrus, coffee and recently those from olive and Xf subsp. sandyi which contains strains from oleander, daylily, magnolia and jacaranda (Hernandez-Martinez et al., 2007; Janse and Obradovic, 2010). Another subsp. of the same bacteria, from chitalpa, was proposed by Randall et al. (2009) and named tashke. This formed a distinct group from the other four subspecies previously mentioned but even today it still remains not fully accepted.
Until 2013, when a severe outbreak of Xf occurred in Apulia region (southern Italy) in the province of Lecce (Loconsole et al., 2014; Saponari et al., 2013), only a few reports of Xf infections on olive existed (Hernandez-Martinez et al., 2007; Wong et al., 2004) and the strain infecting olive was included in the subsp. multiplex or was classified as Genotype A by Chen et al. (2005). Initially, the etiology of the disease which occurred in the Apulia Region was unclear and the disorder was called “Olive Quick Decline Syndrome (OQDS)”. Afterwards, to understand the biology, genetics and phylogeny of Xf strain and subsequently to use all this information to better control this pathogen, a wide range of genes were investigated. Among these genes, one of the most studied and applied was the 16S rDNA gene, which can furnish precious data for Xf classification (Chen et al., 2000a; 2000b; Firrao and Bazzi, 1994; Martinati et al., 2007; Mehta and Rosato, 2001; Schaad et al., 2002) but evolves very slowly and thus, may have quite a minor resolution when used to infer relationships among closely related taxa. Therefore, other taxonomic markers were necessary for species identification such as the gene encoding the B subunit polypeptide of the DNA gyrase (gyrB). This was accepted to develop faster than the ribosomal RNA even preserving an elevated correlation with the whole genome homology (Murray et al., 2001; Rodriquez et al., 2003; Yamamoto and Harayama, 1995; 1996; Yamamoto et al., 1999). Both these previously described molecular markers along with the hypothetical protein HL gene (Francis et al., 2006) were utilized in this study to investigate the Xf strain from Apulia region. Sequence comparisons for 16S rDNA, gyrB and HL genes and phylogeny analyses were performed to explore the nucleotide diversity of the Apulian strain of Xf and to look over its relationships with other Xf taxa.

Materials and Methods

Biologic materials

In winter 2013-early spring 2014, in a Salento area, several samples of mature leaves and twigs were collected from olive trees showing scorch-like symptoms and/or yellowing. The samples were singly closed in double plastic bags, treated with insecticides, brought to the Department of Agricultural, Food and Environmental Sciences at the University of Foggia and subsequently processed in the laboratory of Plant Pathology, accredited to Apulia Region. After analysis, all samples were destroyed by double sterilization at 121°C for 20 min.

DNA isolation

Genomic DNA (gDNA) was extracted from about 0.5-0.8 g of fresh tissue recovered from 5-10 mature leaf peduncles and midribs from symptomatic and healthy samples. Plant tissues were grinded in liquid nitrogen. Total nucleic acids isolation from homogenized plant tissue was performed with DNeasy plant mini kit (Qiagen, Heidelberg, Germany) according to the manufacturer’s instructions with some minor modifications. The extracted gDNA concentration was determined using an ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, Delaware, U.S.A.) and then adjusted to 50-100 ng/μl. DNA samples were stored at −80°C for long term use.

PCR and sequencing

Genomic DNA extracted from symptomatic and healthy olive samples was assessed by polymerase chain reaction (PCR) to detect the presence of the pathogen employing five pairs of species-specific primers: XF1/6, S-S-X.fas-0067-a-S-19/S-S-X.fas-0038-a-A-21, RST31/RST33, FXYgyr499/RXYgyr907 and HL5/6. The first three primers amplified 16S rDNA and RNA polymerase sigma-70 factor genes and the other gyrB gene and hypothetical protein gene (HL), respectively (Table 1). PCR conditions were identical to those reported in the original work of each author mentioned in Table 1. Each PCR reaction contained about 100 ng of gDNA template, 50 μl of 10× PCR Buffer (Invitrogen, Inc., New York, U.S.A.), 0.5 μM of each primer, 100 μM of each dNTP and 1U of Taq DNA polymerase (Invitrogen Inc., New York, U.S.A.) in a total reaction volume of 50 μl. Each assay was performed at least twice and a negative control (no gDNA template) was always included. Amplification products were visualized after electrophoresis in 1.2% agarose gel containing 0.1 μg/ml of ethidium bromide, run in 1X TBE buffer at 80V for 30 min and photographed. Subsequently, PCR amplicons were directly sequenced by BMR Genomics company (Padua, Italy), DNA sequences queried against NCBI database using the Basic Local Alignment Research Tool (BLAST) and megablast algorithm (Altschul et al., 1997), loaded and finally analyzed into MEGA v.6.0 program (Tamura et al., 2013).

Sequences analysis, diversity assessment and phylogeny

Genetic diversity studies have been carried out on the Xf strains from infected olive trees in Apulia. In order to genotype the Xf from olive investigations on SNPs assessment on the three previous mentioned genes were done. All analyses were performed into MEGA6 phylogeny package where nucleotide sequences for each gene were aligned by ClustalW program (Tamura et al., 2013). Evolutionary divergence estimations were also performed in MEGA6 by Maximum Composite Likelihood (MCL) method (Tamura et al., 2004; 2013). Phylogeny reconstruction analyses were carried out using Neighbor-Joining (NJ) statistical method (Saitou and Nei, 1987). Branch support of the phylogenetic tree was tested by bootstrap method with 1000 replications (Felsenstein, 1985) and the nucleotide substitution model was adopted. The phylogenetic tree was inferred by a Kimura-2 Model algorithm (Kimura, 1980) with uniform rates among sites. Gaps/missing data were treated by complete deletion. For all investigations, gDNA nucleotide sequences of the Xf obtained in this study along with some others, downloaded from NCBI’s GenBank and used for comparative analyses, were employed (Table 2).

Results

DNA isolation, PCR and sequencing

About 50-100 ng/μl of gDNA was successfully isolated from infected olive trees and control healthy plants. Amplification of the above described genetic material was also successful and products of expected size were obtained for all genes investigated (Table 1) except for the negative controls. Thirty-four nucleotide sequences belonging to the 16S rDNA, gyrB and HL genes were obtained in this work and deposited into EMBL-EBI nucleotide archive (Table 2).

Sequences analysis, diversity estimation and phylogeny 16S rDNA and RNA polymerase sigma-70 factor genes

The outcomes regarding diversity estimation and phylogeny were similar for the16S rDNA and RNA polymerase sigma-70 factor genes and therefore, only those referred to 16S rDNA gene are presented and discussed below. The final alignment of 16S rDNA gene contained 383 nucleotides. Out of these, 381 were conserved sites and only 2 variable. Two parsimony informative sites were found over the 16S rDNA sequence with no singletons. The average evolutionary divergence over all sequence pairs, computed using the MCL model was 0. All olive 16S rDNA sequences generated in this study shared a 100% identity with the olive strain OL-G2 of Xf (acc. no. KJ406215) and were also 100% identical to each other and to many Xf species and subspecies from various hosts (Fig. 1). Moreover, 16S rDNA gene showed a lower level of variation and only 2 SNPs were counted over a 383 bp length (data not shown). Analyzing the differences over 16S rDNA gene between Xf subsp. pauca strains from olive and those of the same subspecies from other hosts like coffee and citrus, we found only 1 diverse nucleotide. Quite a similar situation (1SNPs) was registered for nucleotide sequences of 16S rDNA of olive strains of Xf subsp. pauca and those from grape of Xf subsp. fastidiosa. The NJ phylogram of aligned and cured 16S rDNA sequences from 31 strains of Xf placed the majority of them into one single group (Clade I) divided into 2 subclades (A and B), with bootstrap values greater than 60% (Fig. 1). Subclade (A) grouped 16S rDNA gene sequences from olive along with those from oleander, plum, mulberry, elm, oak, pin oak, sycamore and ragweed which were placed together with no significant bootstrap support. Within this group, 16S rDNA gene sequences from coffee, citrus and sweet orange grouped together with a moderate bootstrap support of 65%. Subclade (B) grouped together the 16S rDNA gene sequences of grapevine strains with moderate bootstrap support (64%) as shown in Fig. 1. Overall, the high levels of nucleotide sequence similarity of Xylella strains from various hosts did not allowed us to separate them at subsp. level as shown by the single group (Fig. 1).

Gyrase B gene

The final alignment of gyrB gene sequences contained 30 sequences and included a total of 384 nucleotides. Out of these, 371 sites were conserved and 13 variable and parsimony-informative with no singletons. The average evolutionary divergence over all sequence pairs, computed using the MCL model (Tamura et al., 2004), was 0.01. All olive gyrB sequences generated in this study shared a 100% identity with the olive strain OL-G2 of Xf (acc. no. KJ406212) subsp. pauca originated from Italy and were also 100% identical to each other. Furthermore, the gyrB gene showed a high level of variation and 13 SNPs were counted over a 384 bp length (Table 3). Analyzing the differences between Xf strains from olive and those of the Xf subsp. pauca from coffee and citrus only 2 diverse nucleotides were found. Also, gyrB gene nucleotide sequences of Xf from olive, both from this study and one from GenBank, showed an insertion of two bases, which were never seen in all other Xf nucleotide sequences analyzed (data not shown). Among strains of Xf from olive and strains of Xf subsp. multiplex isolated from various hosts (almond, plum, blueberry, elm, ragweed and pin oak) 5 SNPs were registered. A different situation was registered for Xf nucleotide sequences of gyrB gene from olive and those of the same gene belonging to Xf subsp. fastidiosa from grape which were much more variable as 12 SNPs were detected. The NJ phylogram of aligned and cured gyrB gene sequences from 30 strains of Xf showed three clusters, supported with bootstrap values greater than 70% (Fig. 2). The first distinct cluster (I-1) was only formed by Xf isolates, known to belong to the subspecies pauca classified based on the already known nucleotide sequences from GenBank database, and supported by very high bootstrap values of 93%. Moreover, within this cluster two subgroups were detected, one (A) clustering together the Xf isolates from olive with a high bootstrap support (86%) and the other (B) grouping isolates of the same species from coffee and citrus supported by moderate bootstrap values of 64% (Fig. 2). The second distinct cluster (I-2), supported by very high bootstrap values (84%), grouped together strains of X f subsp. multiplex originated from various hosts. The third cluster (Clade II) supported by an excellent bootstrap of 99% and well separated from the other two previously described, grouped sequences of X f subsp. fastidiosa from grape (Fig. 2).

Hypothetical protein gene

Despite a relatively high number of nucleotide sequences of Xf deposited for many genes, including those described before, a very low number of sequences of hypothetical protein (HL) still exist in all public nucleotide databases. All available sequences at the moment of the study were downloaded and analyzed along with the HL nucleotide sequences produced in this work. The final alignment of HL sequences included 14 sequences and contained a total of 216 nucleotides. A total number of 208 sites were conserved and 8 variable of which 6 were parsimony-informative and 2 singletons. The average evolutionary divergence over all sequence pairs using the MCL model (Tamura et al., 2004) was 0.01. Furthermore, olive HL sequences generated in this study were identical to each other and shared a 100% identity with two Xf strains present in GenBank (acc. numbers KJ406211 and HG532020, both originated from olive) and known to belong to the Xf subsp. pauca. The topology of the NJ tree based on HL gene showed that all HL nucleotide sequences from olive grouped together in a distinct cluster (Clade I). This clade (supported by an excellent bootstrap value of 100%) contained strains belonging to Xf subsp. pauca and the subspecies pauca was determined based on their 100% identity to the olive strains of Xf subsp. pauca already present in the NCBI GenBank (Fig. 3). Another distinct cluster (Clade II) was made by strains of Xf subsp. tashke from chitalpa (3 sequences) and one strain from grapevine which belongs to the subsp. fastidiosa, but less than 60% bootstrap support was registered within this cluster (Fig. 3). HL sequences from chitalpa and grape were almost identical except for one single base found in one sequence from chitalpa which can probably be a sequencing error. Results of HL nucleotide sequences obtained in this study confirm recent outcomes of Loconsole et al. (2014) who, detected X. fastidiosa in olive trees using molecular and serology methods and of Giampetruzzi et al. (2015) who, based on the draft genome sequence of Xf CoDiRO strain, classified Xf from olive into subsp. pauca group. Six SNPs were found over 216 bp length of HL nucleotide sequences (Table 4). Even if the length of the gene investigated is quite small, a high diversity was recorded and the SNPs found resulted associated with two types corresponding to different hosts (Table 4). Specific SNPs were only found for olive (Type I) but not for the other two host plants, chitalpa and grape (Type II) as shown in Table 4. The SNPs discovered showed that no association exists between them and phylogenetic subgroups corresponding to an Xf subspecies since strains from two different subspecies e.g. Xf subsp. tashke and Xf subsp. fastidiosa were grouped together (Type II) (Table 4).

Discussion

Diversity and phylogenetic studies carried out on Xf from Apulian olive trees gave us comparable results with the recent studies (Carridi et al., 2014; Elbeaino et al., 2014; Loconsole et al., 2014; Saponari et al., 2013). Phylogenetic trees had slightly different topologies for the three genes investigated although some clusters were maintained in trees originated from data of gyrB and HL genes. For the 16S rDNA gene the distinction between the Xf subsp. was unclear since a unique group containing all Xf strains was observed (Fig. 1). Our results of this gene are concordant with what was previously reported by Mehta and Rosato (2001) who demonstrated that the 16S rDNA sequences of Xf from various host plants, were very similar and a small number of nucleotide substitutions (2 to 4) were only detected in grapevine and plum, also showing that a low level of divergence over 16S rDNA sequences exists. Data from this study also support the results of Chen et al. (2000b) which observed higher levels of heterogeneity in 16S rDNA gene only when Xf was compared to same gene from Xanthomonas and Stenotrophomonas.
Other genes explored in this study like gyrB and HL furnished enough nucleotide variation to identify and classify our Xf strains from olive (Figs. 2 and 3). Findings from this study obtained with gyrB gene are concordant with those of Cariddi et al. (2014) which proved the separation of three subsp. of Xf based on the variation which exists on this gene, even if in their study a single gyrB gene sequence from olive (strain OL-G2) and a smaller number of different gyrB gene sequences from other hosts were considered. Furthermore, SNPs identified, in our work, over the gyrB gene sequence grouped together strains of Xf subsp. pauca into 2 types: type I containing strains from olive and type II harvesting strains of the same subspecies from coffee and citrus. Strains belonging to the Xf subsp. multiplex grouped together (type III) based on their SNPs revealed over gyrB gene independently of their host plant origin. Another type named IV containing strains of Xf subsp. fastidiosa from grape was also recorded (Table 3). Only two types, based on the SNPs counted on HL gene, harvesting strains of Xf from olives (type I) and chitalpa (type II) were found, but this can be explained by the small number of sequences analyzed for this gene and if we could increase their number probably more types could be observed as it was seen for the gyrB gene (Tables 3 and 4).
SNPs analyses for both gyrase B and HL genes showed that olive sequences obtained in this study were identical among them and very similar to the olive Xf sequences already present into GenBank.
Both gyrB and HL genes, were initially employed to detect the presence of Xf (Francis et al., 2006; Rodrigues et al., 2003) and recently used for a preliminary molecular identification of Xf in olives (Saponari et al., 2013). Only one of these (gyrB) was employed to detect the presence of a Xf strain infecting olive and oleander (Carridi et al., 2014) but can be also useful to classify the Xf pathogen at subsp. level.
The epidemic nature of OQDS disease induced by Xf susp. pauca strain CoDiRO (Carridi et al., 2014) on olives in Apulia region and in particular in Lecce province, was already reported and considered to be a consequence of the globalization in the plant movement (Catalano, 2015). Very recently, Nunney et al. (2014) reported a strain of Xf subsp. pauca in Costa Rica on oleander, but in Central America this particular strain was never found on citrus or grape and Costa Rica could be its centre of origin. The same authors also suggest the possible existence of some unknown genetic forms of Xf in South America. They warn us that the formation of novel genetic forms through inter-subspecific recombination could be of great importance because they could be introduced into other regions through plant movement, and as a consequence they may attack commercially important crops (Elbeaino et al., 2014; Nunney et al., 2014). Xf subsp. pauca found in the Salento area is highly similar to Xf subsp. pauca found in Costa Rica. This strain is diverse from other isolates belonging to subspecies pauca, in fact, for example, the CoDiRO strain does not infect citrus as other pauca isolates do. It is very possible that in the near future the CoDiRO strain will be classified as a distinct and new subspecies of Xf.

Fig. 1
Neighbor-joining tree generated in MEGA6 from the 383 bp length alignment of 16S rDNA gene sequences of 31 Xylella fastidiosa specimens, using the Kimura-2 parameter model with uniform rates among sites, complete deletion gap handling and 1000-replication bootstrapping. Nodes with bootstrap values < 60% were eliminated. Bootstrap values are indicated next to relevant nodes. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.
ppj-32-102f1.gif
Fig. 2
Neighbor-joining tree generated in MEGA6 from the 382 bp length alignment of gyrase B subunit gene sequences of 30 Xylella fastidiosa specimens, using the Kimura-2 parameter model with uniform rates among sites, complete deletion gap handling and 1000-replication bootstrapping. Nodes with bootstrap values inferior to 70% were eliminated. Bootstrap values are indicated next to relevant nodes. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.
ppj-32-102f2.gif
Fig. 3
Neighbor-joining tree generated in MEGA6 from the 216 bp length alignment of hypothetical protein HL gene sequences of 14 Xylella fastidiosa specimens, using the Kimura 2-parameter model with uniform rates among sites, complete deletion gap handling and 1000-replication bootstrapping. Nodes with bootstrap values inferior to 30% were eliminated. Bootstrap values are indicated next to relevant nodes. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.
ppj-32-102f3.gif
Table 1
PCR primers used in this study to detect X. fastidiosa in infected olive trees and their relative target genes, PCR product size and references
Target Gene Primers pairs Oligonucloetide sequence (5′→3′) Approx. amplicon size (bp) References
16S rDNA XF1-F CAGCACATTGGTAGTAATAC 404 Firrao and Bazzi, 1994
XF6-R ACTAGGTATTAACCAATTGC

16S rDNA S-S-X.fas-0067-a-S-19 CGG CAG CAC ATT GGT AGT A 603 Rodrigues et al., 2003
S-S-X.fas-0038-a-A-21 CGA TAC TGA GTG CCA ATT TGC

RNA polymerase sigma factor RST31 GCGTTAATTTTCGAAGTGATTCGATTGC 733 Minsavage et al., 1994
RST33 CACCATTCGTATCCCGGTG

Gyrase B FXYgyr499 CAG TTA GGG GTG TCA GCG 420 Rodrigues et al., 2003
RXY gyr907 CTC AAT GTA ATT ACC CAA GGT

Hypothetical protein (HL) HL5 AAGGCAATAAACGCGCACTA 221 Francis et al., 2006
HL6 GGTTTTGCTGACTGGCAACA
Table 2
List of X. fastidiosa taxa used in this study along with their host common names, geographical origin, locus and their GenBank accession numbers with sources
Isolate/strain/clone of X. fastidiosa Host common name Geographical origin Locus GenBank accession no./Source
X. fastidiosa isolate 1408 Olive Italy 16S rDNA LM994844 (this study)
X. fastidiosa isolate 1423 Olive Italy LM994845
X. fastidiosa isolate 1433 Olive Italy LM994846
X. fastidiosa isolate 1440 Olive Italy LM994847
X. fastidiosa isolate 1443 Olive Italy LM994848
X. fastidiosa isolate 1444 Olive Italy LM994849
X. fastidiosa isolate OL-G2 Olive Italy KJ406215 (NCBI GenBank)
X. fastidiosa strain SLS55 Sycamore - DQ991193
X. fastidiosa strain GH-9 Oleander - DQ991185
X. fastidiosa isolate P3 Coffee Brazil AF536769
X. fastidiosa isolate CRS2 Coffee Brazil AF536768
X. fastidiosa strain CO.01 Coffee - AF203390
X. fastidiosa isolate Cafe 20-11 Coffee Brazil EF433946
X. fastidiosa isolate CaVIc2 Coffee Costa Rica EF433949
X. fastidiosa isolate SL1 Citrus Brazil AF536766
X. fastidiosa strain CI.52 Citrus - AF203389
X. fastidiosa isolate B14 Citrus Brazil AF536765
X. fastidiosa isolate Taq30 Sweet orange Brazil EF433947
X. fastidiosa clone 9a6c Sweet orange Brazil NR074922
X. fastidiosa strain 2-5 Plum - DQ991188
X. fastidiosa strain 2-4 Plum - DQ991189
X.fastidiosa isolate MUL-1 Mulberry USA AF224740
X. fastidiosa isolate ELM-1 Elm USA AF536764
X. fastidiosa clone PODon Pine Oak USA DQ022862
X. fastidiosa clone RO1 Red Oak USA DQ021540
X.fastidiosa clone 138H Pine Oak USA DQ022857
X. fastidiosa clone POLime Pine Oak USA DQ021538
X. fastidiosa isolateRGW-R Ragweed USA AF536762
X. fastidiosa isolate VvIIc1 Grapevine Costa Rica EF433937
X. fastidiosa strain GV102 Grapevine Taiwan JN990276
X. fastidiosa strain GV103 Grapevine Taiwan JN990277
X. fastidiosa isolate 1408 Olive Italy RNA pol sigma factor HG941632 (this study)
X. fastidiosa isolate 1409 Olive Italy HG941633
X. fastidiosa isolate 1422 Olive Italy HG941634
X. fastidiosa isolate 1423 Olive Italy HG941635
X. fastidiosa isolate 1426 Olive Italy HG941636
X. fastidiosa isolate 1433 Olive Italy HG941637
X. fastidiosa strain N. 1408 Olive Italy Gyrase-B LM994829
Xylella fastidiosa strain N. 1408 Olive Italy LM994830
X. fastidiosa strain N. 1423 Olive Italy LM994831
X. fastidiosa strain N. 1433 Olive Italy LM994832
X. fastidiosa strain N. 1440 Olive Italy LM994833
X. fastidiosa strain N. 1444 Olive Italy LM994834
X. fastidiosa strain N. 1445 Olive Italy LM994835
X. fastidiosa strain N. 1463 Olive Italy LM994836
X. fastidiosa strain N. 1499 Olive Italy LN811077
X. fastidiosa strain N. 1500 Olive Italy LN811078
X. fastidiosa strain N. 1501 Olive Italy LN811079
X. fastidiosa strain N. 1505 Olive Italy LN811080
X. fastidiosa strain N. 1506 Olive Italy LN811081
X. fastidiosa strain N. 1508 Olive Italy LN811082
X. fastidiosa strain Olive Olive Italy LN811083 (NCBI GenBank)
X. fastidiosa isolate OL-G2 Olive Italy KJ406212
X. fastidiosa isolate SL 1 Citrus Brazil AF534969
X. fastidiosa strain CIT-J8 Citrus Brazil DQ223438
X. fastidiosa strain COF-E21 Coffee Brazil DQ223450
X. fastidiosa strain COF-E10 Coffee Brazil DQ223463
X. fastidiosa strain COF-J62 Coffee Brazil DQ223488
X. fastidiosa isolate P3 Coffee Brazil AF534972
X. fastidiosa strain Georgia 1 Grape USA FJ222898
X. fastidiosa strain Mus 1 Grape USA FJ222901
X. fastidiosa strain Kingsburg Grape USA FJ222902
X. fastidiosa strain M12 Almond USA FJ222927
X. fastidiosa strain GA Plm19b Plum USA F J222918
X. fastidiosa strain Elm Elm USA FJ222919
X. fastidiosa strain BB4 Blueberry USA FJ222914
X. fastidiosa strain RGW-R Ragweed USA AF534963
X. fastidiosa clone 109H Pin Oak USA DQ022643
X. fastidiosa isolate 1422 Olive Italy HL (hypothetical protein) LM994837 (this study)
X. fastidiosa isolate 1423 Olive Italy LM994838
X. fastidiosa isolate 1433 Olive Italy LM994839
X. fastidiosa isolate 1440 Olive Italy LM994840
X. fastidiosa isolate 1443 Olive Italy LM994841
X. fastidiosa isolate 1444 Olive Italy LM994842
X. fastidiosa isolate 1445 Olive Italy LM994843
X. fastidiosa isolate 1507 Olive Italy LN811084
X. fastidiosa isolate OL-1 Olive Italy HG532020 (NCBI GenBank)
X. fastidiosa isolate OL-G2 Olive Italy KJ406211
X. fastidiosa isolate NM01 Chitalpa USA EU714205
X. fastidiosa isolate AZ03 Chitalpa USA EU714207
X.fastidiosa isolate AZ04 Chitalpa USA EU714208
X. fastidiosa isolate NM Grape 01 Grapevine USA EU714209

Note: no data are reported by “-”

Table 3
Single nucleotide polymorphism (SNP) sites registered over 384 base pairs length of X. fastidiosa gyrase subunit B gene DNA sequences found among 30 specimens
Types Species and subspecies Host common name Nucleotide position (No.)

25 89 127 175 193 200 217 220 223 249 322 364 376
I X. fastidiosa subsp. pauca Olive A C T G G T T C T T T C A
II X. fastidiosa subsp. pauca Coffee A A T G G T T T T T T C C
II X. fastidiosa subsp. pauca Citrus A A T G G T T T T T T C C
III X. fastidiosa subsp. multiplex Almond G A C G G T C C T T T C C
III X. fastidiosa subsp. multiplex Plum G A C G G T C C T T T C C
III X. fastidiosa subsp. multiplex Blueberry G A C G G T C C T T T C C
III X. fastidiosa subsp. multiplex Ragweed G A C G G T C C T T T C C
III X. fastidiosa subsp. multiplex Elm G A C G G T C C T T T C C
III X. fastidiosa subsp. multiplex Pin Oak G A C G G T C C T T T C C
IV X. fastidiosa subsp. fastidiosa Grape G A T A A C C A G C C G C
Table 4
Single nucleotide polymorphisms (SNPs) registered over 216 base pairs length of X. fastidiosa hypothetical protein gene DNA sequences found among 14 specimens
Types Species and subspecies Host common name Nucleotide position (No.)

31 69 72 82 174 180
I X. fastidiosa subsp. pauca Olive C T A T G C
II X. fastidiosa subsp. tashke Chitalpa T C G C A G
II X. fastidiosa subsp. fastidiosa Grape T C G C A G

References

Altschul, SF, Madden, TL, Schäffer, AA, Zhang, J, Zhang, Z, Miller, W and Lipman, DJ 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuc Acids Res. 25:3389-3402.
crossref
Cariddi, C, Saponari, M, Boscia, D, De Stradis, A, Loconsole, G, Nigro, F, Porcelli, F, Potere, O and Martelli, GP 2014. Isolation of Xylella fastidiosa strain infecting olive and oleander in Apulia Italy. J Plant Pathol. 96:1-15.
Catalano, L 2015. Xylella fastidiosa la più grave minaccia dell’olivicoltura Italiana. L’Informatore Agrario. 16:36-42.
Chen, JC, Banks, D, Jarret, RL, Chang, CJ and Smith, BJ 2000a. Use of the 16S rDNA sequence as signature characters to identify Xylella fastidiosa. Curr Microbiol. 40:29-33.
pmid
Chen, J, Jarret, RL, Qin, X, Hartung, JS, Banks, D, Chang, CJ and Hopkins, DL 2000b. 16S rSNA Sequence Analysis of Xylella fastidiosa Strains. Syst Appl Microbiol. 23:349-354.
pmid
Chen, J, Groves, R, Civerolo, EJ, Viveros, M, Freeman, M and Zheng, Y 2005. Two Xylella fastidiosa genotypes associated with almond leaf scorch disease on the same location in California. Phytopathology. 95:708-714.
crossref pmid
Cimato, A and Attilio, C 2011. Chapter 1. Worldwide diffusion and relevance of olive culture. In: Olive Diseases and Disorders, eds. by L Schena, GE Agosteo and SO Cacciola, 1-23. Transworld Research Network T.C. 37/661(2), Fort P.O. Trivandrum-695 023, Kerala, India.
EFSA (European Food Safety Authority). 2015. Response to scientific and technical information provided by an NGO on Xylella fastidiosa. EFSA J. 13:4082.
crossref
Elbeaino, T, Valentini, F, Abou Kubaa, R, Moubarak, P, Yaseen, T and Digiaro, M 2014. Multilocus sequence typing of Xylella fastidiosa isolated from olive affected by ”olive quick decline syndrome” in Italy. Phytopathol Medit. 53:533-542.
Felsenstein, J 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 39:783-791.
crossref pmid pdf
Firrrao, G and Bazzi, C 1994. Specific identification of Xylella fastidiosa using the polymerase chain reaction. Phytopathol Medit. 33:90-92.
G Fontanazza and J Benites Pisante, M and Stagnari, F 2005. Integrated soil and water management for orchard development, role and importance. FAO Land Water Bull. 1024-6703(10):13-20.
Francis, M, Lin, H, Cabrera-La Rosa, J, Doddapaneni, H and Civerelo, EL 2006. Genome-based PCR primers for specific and sensitive detection and quantification of Xylella fastidiosa. Eur J Plant Pathol. 115:203-213.
crossref pdf
Giampetruzzi, A, Chiumenti, M, Saponari, M, Donvito, G, Italiano, A, Loconsole, G, Boscia, D, Cariddi, G, Martelli, GP and Saldarelli, P 2015. Draft genome sequence of the Xylella fastidiosa CoDiRO strain. Genome Announc. 3:01538-14.
crossref pdf
Hernandez-Martinez, R, de la Cerda, KA, Costa, HS, Cooksey, DA and Wong, FP 2007. Phylogenetic relationships of Xylella fastidiosa strains isolated from landscape ornamentals in southern California. Phytopathology. 97:857-864.
crossref pmid
Hopkins, DL 1989. Xylella fastidiosa: xylem-limited bacterial pathogen of plants. Ann Rev Phytopathol. 27:271-290.
crossref
Hopkins, DL and Purcell, AH 2002. Xylella fastidiosa: Cause of Pierce’s Disease of grapevine and other emergent diseases. Plant Dis. 86:1056-1066.
crossref pmid
IOC. 2009. Olive Products market report summary (No. 33, July-September 2009). Market Commentary.
Janse, JD and Obradovic, A 2010. Xylella fastidiosa: its biology, diagnosis, control and risks. J Plant Pathol. 92(1 Supplement):35-48.
Kimura, M 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 16:111-120.
crossref pmid pdf
Loconsole, G, Potere, O, Boscia, D, Altamura, G, Djelouah, K, Elbeaino, T, Frasheri, D, Lorusso, D, Palmisano, F, Pollastro, P, Silletti, MR, Trisciuzzi, N, Valentini, F, Savino, V and Saponari, M 2014. Detection of Xylella fastidiosa in olive trees by molecular and serological methods. J Plant Pathol. 96:7-14.
Martinati, JC, Pacheco, Hansen, Oliveira de Miranda, FT, VF, and Tsai, SM 2007. 16S-23S. rDNA: Polymorphisms and their use for detection and amplification of Xylella fastidiosa strains. B J Microbiol. 38:159-165.
Mehta, A and Rosato, YB 2001. Phylogenetic relationships of Xylella fastidiosa strains from different hosts based on 16S rDNA and 16S-23S intergenic spacer sequences. Int J Sys Evol Microbiol. 51:311-318.
crossref
Murray, AE, Lies, D, Li, G, Nealson, K, Zhou, J and Tiedje, JM 2001. DNA/DNA hybridization to microarrays reveals gene-specific differences between closely related microbial genomes. Proc Nat Acad Sci USA. 98:9853-9858.
crossref pmid pmc
Nunney, L, Ortiz, B, Russell, SA, Ruiz Sánchez, R and Stouthamer, R 2014. The Complex Biogeography of the Plant Pathogen Xylella fastidiosa: Genetic Evidence of Introductions and Subspecific Introgression in Central America. PLoS ONE. 9:e112463
crossref pmid pmc
Purcell, AH and Hopkins, DL 1996. Fastidious xylem-limited bacterial plant pathogens. Ann Rev Phytopathol. 3:131-151.
crossref
Purcell, AH 2013. Paradigms: Examples from the bacterium Xylella fastidiosa. Ann Rev Plant Pathol. 51:229-356.
crossref
Randal, JJ, Golberg, NP, Kemp, JP, Radionenko, M, French, JM, Olsen, MW and Hanson, SF 2009. Genetic analysis of a novel Xylella fastidiosa subspecies found in the south western United States. Appl Environ Microbiol. 75:5631-5638.
crossref pmid pmc pdf
Rodrigues, JLM, Silva-Stenico, ME, Gomes, JE, Lopes, JRS and Tsai, SM 2003. Detection and Diversity Assessment of Xylella fastidiosa in Field-Collected Plant and Insect Samples by Using 16S rRNA and gyr B Sequences. Appl Environ Microbiol. 69:4249-4255.
crossref pmid pmc pdf
Saitou, N and Nei, M 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Molec Biol Evol. 4:406-425.
pmid
Saponari, M, Boscia, D, Nigro, F and Martelli, GP 2013. Identification of DNA sequences related to Xylella fastidiosa in oleander, almond and olive trees exhibiting leaf scorch symptoms in Apulia (Southern Italy). Disease Note. J Plant Pathol. 94(3):688.
Schaad, NW, Opgenorth, D and Gaush, P 2002. Real-time polymerase chain reaction for one-hour on-site diagnosis of grape early season asymptomatic vines. Phytopathology. 92:721-728.
crossref pmid
Schaad, NW, Postnikova, E, Lacy, G, Fatmi, M and Chang, CJ 2004. Xylella fastidiosa subspecies: X. fastidiosa subsp. fastidiosa subsp. nov., X. fastidiosa subsp. multiplex subsp. nov., and X. fastidiosa subsp. pauca subsp. nov. Syst Appl Microbiol. 27:290-300.
pmid
Schuenzel, EL, Scally, M, Stouthamer, R and Nunney, L 2005. A multigene phylogenetic study of clonal diversity and divergence in North American strains of the plant pathogen Xylella fastidiosa. Appl Environ Microbiol. 71:3832-3839.
crossref pmid pmc pdf
Simpson, AJG, Reinach, FC, Arruda, P and et al 2000. The genome sequence of the plant pathogen Xylella fastidiosa. Nature. 406:151-157.
pmid
Tamura, K, Nei, M and Kumar, S 2004. Prospects for inferring very large phylogenies by using the neighbour-joining method. Proc Nat Acad Sci USA. 101:11030-11035.
pmid pmc
Tamura, K, Stecher, G, Peterson, D, Filipski, A and Kumar, S 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 30:2725-2729.
crossref pmid pmc
Yamamoto, S and Harayama, S 1995. PCR amplification and Direct Sequencing of gyrB genes with Universal Primers and Their Application to the Detection and Taxonomic Analysis of Pseudomoans putida Strains. Appl Environ Microbiol. 61:1104-1109.
crossref pmid pmc pdf
Yamamoto, S and Harayama, S 1996. Phylogenetic analysis of Acinetobacter strains based on nucleotide sequences of gyrB genes and on the amino acid sequences of their products. Int J Syst Bact. 46:506-511.
Yamamoto, S, Bouvet, PJ and Harayama, S 1999. Phylogenetic structures of the genus Acinetobacter based on gyrB sequences: comparison with the grouping by DNA-DNA hybridization. Int J Syst Bact. 49:87-95.
crossref
Wells, JM, Raju, BC, Hung, HY, Weisburg, WG, Mandelco-Paul, L and Brenner, DJ 1987. Xylella fastidiosa gen. nov., sp. nov.: Gram-negative, xylem-limited, fastidious plant bacteria related to Xanthomonas spp. Int J Syst Biol. 37:136-143.
crossref
Wong, F, Cooksey, DA and Costa, HS 2004. Documentation and characterization of Xylella fastidiosa strains in landscape hosts. CDFA Pierce’s Diseases Control Program Progress Report. In: Proceedings Pierce’s Diseases Research Symposium; December 5-7; San Diego, CA, USA.


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next