Plant Pathol J > Volume 38(5); 2022 > Article
Chen, Pan, Tao, Yang, Deng, Xu, Chen, and Li: Plant Virome Analysis by the Deep Sequencing of Small RNAs of Fritillaria thunbergii var. chekiangensis and the Rapid Identification of Viruses

Abstract

Thunberg fritillary (Fritillaria thunbergii), a perennial used in traditional Chinese herbal medicine, is a members of the family Liliaceae. The degeneration of germplasm is a severe problem in the production of Fritillaria thunbergii var. chekiangensis. However, no information about viral infections of F. thunbergii var. chekiangensis has been reported. In this study, we sequenced the small RNAs of F. thunbergii var. chekiangensis from leaves and bulbs, and viruses were identified using a phylogenetic analysis and BLAST search for sequence. In addition, multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) was used to rapidly detect viruses in this variety. Our study first reported that five viruses infected F. thunbergii var. chekiangensis. Among them, fritillary virus Y (FVY), lily mottle virus (LMoV), Thunberg fritillary mosaic virus (TFMV), and hop yellow virus (HYV) had been reported in F. thunbergii, while apple stem grooving virus was first reported in the genus Fritillaria. A multiplex RT-PCR method was developed to rapidly test the four viruses FVY, LMoV, TFMV, and HYV in F. thunbergii var. chekiangensis. Our results provide a better understanding of the infection of F. thunbergii var. chekiangensis by viruses and a basic reference for the better design of suitable control measures.

Thunberg fritillary (Fritillaria thunbergii), a perennial herb in the Liliaceae family, is a traditional Chinese medicine and listed as one of the famous “eight flavors of Zhejiang” (Wu et al., 2021). The dry bulbs of F. thunbergii, called “Zhebei,” are often utilized to treat coughs caused by bronchitis, inflammation, hypertension, gastric ulcers, diarrhea, bacterial infections and drug-resistant leukemia (Cui et al., 2018; Wang et al., 2013). F. thunbergii var. chekiangensis is primarily produced in Dongyang City and Pan’an County, Zhejiang Province (Li et al., 1999). The bulbs of the plant are called “Dongbei” and are generally considered as a superior product of “Zhebei” (Li et al., 1999). F. thunbergii var. chekiangensis was introduced to locations away from its indigenous area to better promote and expand its utilization (Xu and Li, 1999). However, the germplasm resources of F. thunbergii var. chekiangensis have been degenerated and endangered now. Exploring the possible mechanisms that could cause the extinction of F. thunbergii var. chekiangensis are important for the rescue and utilization of this variety.
Low level germplasm is a severe problem in the production of F. thunbergii (Chen and Qian, 2002), which could be caused by viral infections in the leaves and bulbs of this species (Chen et al., 2006; Qin et al., 2006; Wei et al., 2005). Wei et al. (2005) isolated a potyvirus that causes mosaic symptoms in fresh leaves of Thunberg fritillary that were collected from fields in Ningbo City and Panan County, Zhejiang province and found it was most closely related to lily mottle virus (LMoV) (53.0% amino acid identity), leek yellow stripe virus, and lycoris mild mottle virus (72.8% nt identity in their coat protein cistrons). It was finally named Thunberg fritillary mosaic virus (TFMV) (Wei et al., 2005). Chen et al. (2006) isolated another potyvirus from fresh leaves of Thunberg fritillary and found that it was a member of the bean common mosaic virus subgroup. The most closely related species are soybean mosaic virus and Wisteria vein mosaic virus, with 68-69% amino acid identity between their polyproteins. It was finally named fritillary virus Y (FVY) (Chen et al., 2006). Thunberg fritillary was verified to be a new host of LMoV (Qin et al., 2006) and potato leaf roll virus (Qin, 2006) using reverse transcription polymerase chain reaction (RT-PCR). Recently, the amount of F. thunbergii var. chekiangensis produced has been shrinking yearly. Some detrimental trends, such as mosaic and leaf mottle symptoms and a reduction in the number of bulbs, appeared during the cultivation of F. thunbergii var. chekiangensis. Although F. thunbergii has been studied, it was unclear whether F. thunbergii var. chekiangensis was infected by these viruses until this study.
Plant and invertebrates can protect themselves from viral infection through RNA silencing, which is induced by small RNAs (sRNAs) that are 21-30 nucleotides long (Ding and Voinnet, 2007). Recently, virome analysis based on deep sRNA sequencing has been developed to identify and detect viruses in plants without any previous knowledge of their viral genomes (Bi et al., 2012; Golyaev et al., 2019; Massart et al., 2017; Roossinck et al., 2015; Singh et al., 2020). In addition, virome analyses based on deep sRNA sequencing are 10-fold more sensitive than those that utilize RT-PCR (Santala and Valkonen, 2018). However, there has not been a comprehensive study using virome analysis based on deep sRNA sequencing for F. thunbergii and its varieties.
In this study, we sequenced the sRNAs of F. thunbergii var. chekiangensis from leaves and bulbs and identified the viruses using phylogenetic analyses and BLAST search for sequence. In addition, a multiplex RT-PCR was used to rapidly detect viruses in the different tissues of F. thunbergii var. chekiangensis. To our knowledge, this study is the first to reveal viral populations in F. thunbergii var. chekiangensis and provides a multiplex RT-PCR method to rapidly detect viruses in this variety.

Materials and Methods

Plant materials

F. thunbergii var. chekiangensis was cultured in the main original cultivation basement in Houge Village, Pan’an County, Zhejiang Province, China (120″36′09E, 28″57′56N). The area is a humid subtropical monsoon climate with an annual mean temperature from 13.9°C to 17.4°C and annual mean precipitation from 1,409.8 mm to 1,527.8 mm. The leaves and bulbs of F. thunbergii var. chekiangensis were collected in April 2021. Leaves and bulbs from three individuals were collected as three biological replicates. After collection, all the samples were frozen in liquid nitrogen and stored at −80°C until further analysis.

Extraction of total RNA

Total RNA from leaves and bulbs was extracted using an RNAprep Pure Plant Kit (Tiangen Biotech Co., Ltd., Beijing, China). The purity of total RNA was determined using a NanoPhotometer (Implen, Inc., Westlake Village, CA, USA), and the content of total RNA was determined using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The integrity of total RNA was evaluated using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA).

Library construction and sequencing

The sRNA libraries were constructed using an NEB Next Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs Inc., Ipswich, MA, USA) following the manufacturer’s instructions. Schematic diagram was shown in Supplementary Fig. 1. Index codes were added to attribute the sequences to each sample. Six sRNA libraries of leaves and bulbs from three plants were constructed. An NEB 3′ SR Adaptor was directly and specifically ligated to the 3′ end of microRNA, small interference (siRNA) and PIWI-interacting RNA. After the 3′ ligation reaction, the SR RT Primer hybridized to the excess of 3′ SR Adaptor that remained free after the 3′ ligation reaction transformed the single-stranded DNA adaptor into a double-stranded DNA molecule. mRNAs with a poly-A tail were extracted using poly-T oligo-attached magnetic beads. The purified mRNAs were subjected to the first strand of cDNA followed by a second strand of cDNA, and the 3′ ends were adenylated. The first strand cDNA was then synthesized using M-MuLV Reverse Transcriptase (RNase H) (New England Biolabs Inc.). LongAmp Taq 2× Master Mix (New England Biolabs Inc.), SR Primer for Illumina and index (X) primer were utilized to amplify the fragments. The RT-PCR products were purified, and the DNA fragments that corresponded to 140-160 bp (the length of small noncoding RNA plus the 3′ and 5′ adaptors) were recovered and dissolved in elution buffer. Finally, the quality of library was assessed on an Agilent Bioanalyzer 2100 system (Agilent Technologies). The clustering of these samples with an adapter was performed on a cBot Cluster Generation System using a Tru Seq SR Cluster Kit v3-c Bot-HS (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. After cluster generation, Novogene Corporation, Inc. (Beijing, China) sequenced the RNA on an Illumina NovaSeq 6000 platform, which generated 50 bp single end reads. All the raw data were submitted to the NCBI database with the accession number of SRR18739256 and SRR18739255.

Bioinformatics analysis

Raw reads of the FASTA format were first processed using custom Perl and Python scripts. Clean reads were obtained by removing the reads that contained poly N, with 5′ adapter contaminants, without a 3′ adapter or insert tag, poly A or T or G or C and low-quality reads from raw data. The plants that are infected with viruses accumulate high levels of viral siRNAs of the three major size classes: 21-nt, 22-nt, and 24-nt (Aregger et al., 2012). Size ranges from 18- to 26-nt was selected from the clean reads for further research. sRNA reads 18- to 26-nt long were assembled into contigs using Velvet 1.2.10 (https://www.ebi.ac.uk/~zerbino/velvet/) and SPAdes 3.15.3 (http://cab.spbu.ru/software/spades/) to identify the viruses. The contigs from these two types of software were combined and processed with Cap3 (http://doua.prabi.fr/software/cap3). The contigs were blasted on the NCBI nucleotide BLAST database (BLASTN and BLASTX), and the annotated information of viruses related to contigs was screened to obtain the candidate virus list. The most closely related reference sequences of the viral species were analyzed in more detail. The candidate virus list was further corrected by mapping the 18- to 26-nt sRNA reads to the database composed of screened virus nucleic acid sequences using Bowtie 2 (Langmead and Salzberg, 2012) with up to 1 mismatch.

Multiple sequence alignment and phylogenetic analysis

Phylogenetic trees were constructed using Clustal X (version 2.1) (http://www.clustal.org/clustal2/) with default parameters and the maximum likelihood method in MEGA 7.0 (http://www.megasoftware.net/). The reliability of branches was inferred from a bootstrap analysis of 1,000 replicates. The final phylogenetic tree was then edited using ITOL (http://itol.embl.de/).

Validation of viruses using RT-PCR and sequencing

Five primer pairs were designed to confirm the results of sRNA-seq based on references and contig sequences by conducting RT-PCR in different leaf and bulb samples (Supplementary Table 1). The cDNA was amplified from the total RNA using a TIANScript II RT Kit (Tiangen Biotech Co., Ltd.) following the manufacturer’s instructions with conditions of 25°C for 10 min, 42°C for 60 min, 70°C for 15 min, and storage at 4°C. The cDNA was used as template for amplification. The RT-PCR conditions were 98°C for 30 s, followed by 30 cycles at 98°C for 10 s, 65°C to 68°C for 30 s (the annealing temperature is listed in Supplementary Table 1), and 72°C for 1 min, with a final extension at 72°C for 10 min. We checked the amplified RT-PCR products by 1.0% gel electrophoresis. The RT-PCR product was sequenced by Sangon Shanghai Co., Ltd. (Shanghai, China). The sequence was blasted on the NCBI nucleotide BLAST database to test the similarity between viruses.

Rapid detection of viruses using a multiplex RT-PCR assay

To enable the rapid identification of viruses in F. thunbergii var. chekiangensis, we designed five RT-PCR primer pairs to conduct multiplex RT-PCR assay. Detail of the primer pairs are shown in Table 1. We used the same total RNA from the pooled samples as a template, and the cDNA was amplified as described above. The RT-PCR conditions were 98°C for 30 s, followed by 30 cycles at 98°C for 10 s, 66°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. To ensure the absence of contaminants, each RT-PCR run included a negative (water) control. We checked the amplified RT-PCR products by gel electrophoresis.

Results

Overview of sRNA-seq

A total of 13,779,494 and 11,850,879 clean reads were generated from the bulb and leaf libraries, respectively, having base quality scores ≥ Q30 (Table 2). Size ranges from 18- to 26-nt were selected, and 12,269,337 and 7,071,885 reads were screened from the bulb and leaf libraries, respectively. Among them, 21-nt reads were the most abundant (51.26% and 34.1% in the bulbs and leaves, respectively), followed by 22-nt (23.11% and 14.86% in the bulbs and leaves, respectively) (Fig. 1).
Clean reads from two libraries were individually assembled using SPAdes and Velvet. A total of 267 and 120 contigs were obtained from the bulb and leaf libraries when assembled by SPAdes, and 383 and 419 contigs were obtained when assembled by Velvet, while 354 and 201 contigs were obtained when they were both merged (Table 2).

Phylogenetic relationship of the contigs

The assembled contigs were annotated and compared with the virus reference database in GenBank using BLAST. Apple stem grooving virus (ASGV) or citrus tatter leaf virus (CTLV) (32 contigs) was the dominant virus that infected F. thunbergii var. chekiangensis followed by LMoV (26 contigs) and TFMV (26 contigs) (Table 3).
In the phylogenetic tree using the contigs from bulb and leaf libraries (Fig. 2), contig67 plus contig69 which was concatenated by two assembled contigs, was 100% similar to FVY (AM039800.1). Contig1 and contig68 were both 100% similar to LMoV (MT795719.1). Contig70 was 98.28% similar to hop yellow virus (HYV, MN520242.1). Contig multiple 1 (Fig. 3A) was 97.25% similar to CTLV (MH108979.1), 92.86% similar to pear black necrotic leaf spot virus (PBNLSV; AY596172.1), 95.60% similar with ASGV (KR185346.1), and 84.70% similar to breadfruit capillovirus 1 (BCV1; MW328738.1). Fig. 3B indicates 100% similarity to TFMV (NC007180.1).

Identification of viruses

The results of RT-PCR of the five viruses are shown in Fig. 4. All the primer pairs yielded amplicons of the expected size. The sequences of the RT-PCR products of “FVY”, “TFMV”, and “LMoV” were 99.12%, 98.08%, and 98.50% identical to those of FVY (AM039800.1), TFMV (HM584812.1), and LMoV (MK368802.1), respectively. The sequences of the RT-PCR product of “HYV” were 98.49% identical with that of HYV (MN520242.1) and 94.92% identical with that of grapevine line pattern virus (MW888442.1). The sequence of the RT-PCR product “ASGV” was 94.40% identical with ASGV (LC143387.1) and 94.18% with CTLV (MH108979.1).
Based on the evidence, five and three viruses were identified in the leaves and bulbs, respectively (Table 3). Among them, FVY, LMoV, and TFMV are species in the genus Potyvirus of the family Potyviridae. HYV is a species in the genus Anulavirus of the family Bromoviridae. ASGV is a species in the genus Capillovirus of the family Betaflexiviridae, and alternatively, CTLV is considered as a strain of ASGV (Tatineni et al. 2009).

Rapid detection by multiplex RT-PCR

Multiplex RT-PCR was used to rapidly detect multiple viruses in one reaction. After primer design and condition optimization, multiplex RT-PCR with the amplification of four primer pairs succeeded (Table 1). Four RT-PCR fragments with the expected size are shown in Fig. 5, indicating that the multiplex RT-PCR identified the four viruses FVY, LMoV, TFMV, and HYV in F. thunbergii var. chekiangensis. Unfortunately, primer pairs for ASGV could not be amplified in the multiplex RT-PCR experiment.

Discussion

High-throughput sequencing technology and bioinformatics analysis of the sRNA population isolated from plants allows universal virus detection. For example, Singh et al. (2020) confirmed the presence of three known viruses, and also confirmed the first report of cereal yellow dwarf virus and wheat yellow dwarf virus in wheat using the de novo assembly of high-quality contigs. In our study, 143 contigs were identified in F. thunbergii var chekiangensi through sRNA-seq data mining. To our knowledge, this is the first report of FVY, LMoV, TFMV, HYV, and ASGV (or CTLV) in F. thunbergii var. chekiangensis. FVY, LMoV, TFMV, and HYV were reported from F. thunbergii (https://www.ncbi.nlm.nih.gov/nuccore/MN520242.1/) (Chen et al. 2006; Qin et al. 2006; Wei et al. 2005), while ASGV (or CTLV) was first reported in the genus Fritillaria.
At first, LMoV was considered to only spread among lilies (Asjes, 2000). However, F. thunbergii was later verified as a host of LMoV (Qin et al., 2006). TFMV is a new potyvirus found in the leaves of F. thunbergii in both Ningbo and Pan’an cities, Zhejiang Province, China (Wei et al., 2005). The leaves of most plants display mottle and mosaic symptoms after infection (Wei et al., 2005). FVY is a potyvirus that coexists with TFMV in the leaves of F. thunbergii in Ningbo and Panan cities, Zhejiang Province, China (Chen et al., 2006). However, FVY is not widespread in the fields of F. thunbergii, and only 22.85% of the plants were infected with FVY (Chen et al., 2006). In our study, the above three viruses were found in the leaves of F. thunbergii var. chekiangensis, while only LMoV and FVY were found in the bulbs of this variety.
HYV is a tentative member of the genus Anulavirus of the family Bromoviridae. The complete sequence of HYV isolated from F. thunbergii was accepted in NCBI (Lu Y, unpublished data). However, no other information on this virus is currently available. In our study, the contig70 was 98.276%, 93.863%, and 93.636% identical with those of HYV (MN520242.1), Amazon lily mild mottle virus (ALiMMV) (MT362772.1), and grapevine line pattern virus (GLPV) (MT309111.1), respectively. The RT-PCR product and HYV (MN520242.1) had the highest degree of homology (98.49%). The presence of HYV in F. thunbergii (Lu Y, unpublished data) led us to hypothesize that the virus can be found in F. thunbergii var. chekiangensis. However, more studies are needed to verify the characterization of HYV in F. thunbergii var. chekiangensis.
In our study, the contig multiple 1 was 97.253% similar to CTLV and 95.604% similar to ASGV (KR185346.1). However, the primer pairs designed based on the sequence of ASGV obtained an amplicon of the expected size, and the RT-PCR product was 94.40% identical with ASGV (LC143387.1) and 94.18% with CTLV. Tatineni et al. (2009) considered that CTLV is a strain of ASGV. Song et al. (2015) reported that CTLV may be not a distinct strain of ASGV, and proposed that CTLV should be renamed as ASGV following a complete genome sequence analysis of two CTLV isolates from China. Further studies, including the isolation of virus and the amplification of the complete sequences, are needed to confirm the presence of ASGV or CTLV in the genus Capillovirus (Betaflexiviridae family) in F. thunbergii var. chekiangensis.
The multiplex RT-PCR assays can help to save time and costs in testing for multiple viruses. Liu et al. (2018) developed multiplex RT-PCR primers to successfully detect six respiratory viruses using TaqMan probes in a single reaction. Menzel et al. (2002) found that the multiplex RT-PCR assays described are reliable, rapid, and sensitive methods to detect these viruses and may replace techniques that commonly require indexing by woody indicators or enzyme-linked immunosorbent assay. In our experiment, we designed the RT-PCR primer pairs, optimized the conditions for PCR, and found that the multiplex RT-PCR identified the four viruses FVY, LMoV, TFMV, and HYV in F. thunbergii var. chekiangensis, although it did not detect ASGV.
Our results are the first report of the identification of five viruses in F. thunbergii var. chekiangensis using the sRNA deep sequencing method. Among them, FVY, LMoV, TFMV, and HYV had been reported in F. thunbergii, while ASGV was first reported in the genus Fritillaria. Further studies are needed to confirm the presence of ASGV or a new virus in the genus Capillovirus (Betaflexiviridae family) in F. thunbergii var. chekiangensis. A multiplex RT-PCR method was developed to rapidly test four viruses of FVY, LMoV, TFMV, and HYV in F. thunbergii var. chekiangensis. Our results should provide a better understanding of the infection of F. thunbergii var. chekiangensis by viruses, and thus, enable the design of suitable control measures, which can provide technical support for the culture and development of F. thunbergii var. chekiangensis in the future.

Acknowledgments

This work was carried out with the support of the demonstration project of traditional Chinese medicinal green development in Pan’an County (202004), China.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

Fig. 1
Distribution of reads with different length screened from the bulb (A) and leaf (B) libraries of Fritillaria thunbergii var. chekiangensis.
ppj-oa-04-2022-0058f1.jpg
Fig. 2
Phylogenetic tree reconstruction using the neighbor-joining method based on alignment.
ppj-oa-04-2022-0058f2.jpg
Fig. 3
(A) Contig multiple 1, which include 6 contigs. (B) Contig multiple 2, which include 21 contigs.
ppj-oa-04-2022-0058f3.jpg
Fig. 4
Representative results for the detection of lily mottle virus (A), hop yellow virus (B), fritillary virus Y (C), apple stem grooving virus (D), and Thunberg fritillary mosaic virus (E) by reverse transcriptase-polymerase chain reaction (RT-PCR). M, DNA marker (100-5,000 bp); lane 1, RT-PCR product. The size of RT-PCR products from (A) to (E).
ppj-oa-04-2022-0058f4.jpg
Fig. 5
Representative results to detect fritillary virus Y, lily mosaic virus, Thunberg fritillary mosaic virus, and hop yellow virus by multiplex reverse transcriptase-polymerase chain reaction (RT-PCR). M, DNA marker (100-2,000 bp); lane 1-3, RT-PCR products.
ppj-oa-04-2022-0058f5.jpg
Table 1
Primers used for multiplex RT-PCR and the size of products
Virus Primer name Sequences (5′-3′) Size of product (bp)
TFMV TFMV5831-6409F GCAAAGAATAAACGTCAGAGACAGA 579
TFMV5831-6409R TTCAAACACTAAACTCTCGGTTTCTTTCT
LMoV LMoV1083-2456F TCGGGCCCAGGCGATAAATT 1,374
LMoV1083-2456R GCCGACCTGGTAGTGCTTCA
FVY FVY6305-7033F AGCAGGTCAGTTTACAAAGGACT 729
FVY6305-7033R CTGGACTGCCACTGTGTCAC
HYV HYV-F TTGACGACAGACTACGATCTTCCATTG 250
HYV-R ACTCGGTAACGCAACTCAGAACATC
ASGV ASGV4787-5749F ATGGCTATCGTCAACGTCAACC 963
ASGV4787-5749R TCAGGGGGAGGAACCGTCAG

RT-PCR, reverse transcriptase-polymerase chain reaction; TFMV, Thunberg fritillary mosaic virus; LMoV, lily mottle virus; FVY, fritillary virus Y; HYV, hop yellow virus; ASGV, apple stem grooving virus.

Table 2
Length distribution of assembled contigs in the libraries of bulbs and leaves of Fritillaria thunbergii var chekiangensi
Library Software No. of contigs 0-200 bp 200-500 bp 500-1k bp 1k-2k bp >2k bp N50 N90
Bulbs SPAdes 267 0 258 6 1 2 248 74
Leaves SPAdes 120 0 95 17 5 3 613 207
Bulbs Velvet 383 172 153 38 15 5 440 147
Leaves Velvet 419 159 185 48 23 4 486 166
Bulbs Mergea 354 243 77 24 7 3 526 124
Leaves Mergea 201 80 72 26 18 5 793 201

a The contigs from two types of software were combined.

Table 3
Viruses identified from the viromes in the bulbs and leaves of Fritillaria thunbergii var chekiangensi using small RNA (sRNA) deep sequencing and the number of contigs
Organs Family/Genus NCBI reference Annotation No. of contigs E-value
Leaf Potyviridae/Potyvirus AM039800.1 Fritillary virus Y 18 2.50426E-37
MT795719.1 Lily mottle virus 21 4.50283E-49
NC007180.1 Thunberg fritillary mosaic virus 26 1.39101E-10
Bromoviridae/Anulavirus MN520242.1 Hop yellow virus 7 4.2216E-10
Betaflexiviridae/Capillovirus KR185346.1 Apple stem grooving virusa 32 1.4197E-07
MH108979.1 Citrus tatter leaf virusa
Bulb Potyviridae/Potyvirus AM039800.1 Fritillary virus Y 1 1.28E-07
MT795719.1 Lily mottle virus 26 5.62875E-07
Bromoviridae/Anulavirus NC007180.1 Hop yellow virus 12 1.28E-07

a Both of species are the potential virus in the leaves of F. thunbergii var chekiangensi based on the data of sRNA sequencing.

References

Aregger, M, Borah, BK, Seguin, J, Rajeswaran, R, Gubaeva, EG, Zvereva, AS, Windels, D, Vazquez, F, Blevins, T, Farinelli, L and Pooggin, MM 2012. Primary and secondary siRNAs in geminivirus-induced gene silencing. PLoS Pathog 8:e1002941.
crossref pmid pmc
Asjes, CJ 2000. Control of aphid-borne Lily symptomless virus and Lily mottle virus in Lilium in the Netherlands. Virus Res 71:23-32.
crossref pmid
Bi, Y, Tugume, AK and Valkonen, JPT 2012. Small-RNA deep sequencing reveals Arctium tomentosum as a natural host of Alstroemeria virus X and a new putative Emaravirus. PLoS ONE 7:e42758.
crossref pmid pmc
Chen, J, Zheng, H-Y, Shi, Y-H, Adams, MJ, Wei, C-B, Lin, L and Chen, J-P 2006. Detection and characterisation of a second potyvirus from Thunberg fritillary in China. Arch. Virol 151:439-447.
crossref pmid pdf
Chen, XL and Qian, WW 2002. Advances and prospect of production and development of Zhejiang Chinese crude drugs. J. Zhejiang Col. Tradit. Chin. Med 26:61-64 (in Chinese).
Cui, M-C, Chen, S-J, Wang, H-H, Li, Z-H, Chen, H-J, Chen, Y, Zhou, H-B, Li, X and Chen, J-W 2018. Metabolic profiling investigation of Fritillaria thunbergii Miq. by gas chromatography-mass spectrometry. J. Food Drug Anal 26:337-347.
crossref pmid
Ding, SW and Voinnet, O 2007. Antivirial immunity directed by small RNAs. Cell 130:413-426.
crossref pmid pmc
Golyaev, V, Candresse, T, Rabenstein, F and Pooggin, MM 2019. Plant virome reconstruction and antiviral RNAi characterization by deep sequencing of small RNAs from dried leaves. Sci. Rep 9:19268.
crossref pmid pmc pdf
Langmead, B and Salzberg, SL 2012. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9:357-359.
crossref pmid pmc pdf
Li, BL, Chen, ZL, Zhu, K, Bao, WY and Jin, K 1999. Pharmacognostic identification of Fritillaria thunbergii Miq. Var. chekiangensis Hsiao et K.C. Hsia. J. Chin. Med. Mater 22:16-17 (in Chinese).
Liu, P, Lu, L, Xu, M, Zhong, H, Jia, R, Su, L, Cao, L, Dong, Z, Dong, N, Zhou, L and Xu, J 2018. A novel multiplex PCR for virus detection by melting curve analysis. J. Virol. Methods 262:56-60.
crossref pmid pmc
Massart, S, Candresse, T, Gil, J, Lacomme, C, Predajna, L, Ravnikar, M, Reynard, J-S, Rumbou, A, Saldarelli, P, Škorić, D, Vainio, EJ, Valkonen, JPT, Vanderschuren, H, Varveri, C and Wetzel, T 2017. A framework for the evaluation of biosecurity, commercial, regulatory, and scientific impacts of plant viruses and viroids identified by NGS technologies. Front. Microbiol 8:45.
crossref pmid pmc
Menzel, W, Jelkmann, W and Maiss, E 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J. Virol. Methods 99:81-92.
crossref pmid
Qin, CJ 2006. Detecting viruses by RT-PCR in Fritillaria thunbergii and fuling polysaccharide on non-specific immune function in Pelodiscus sinensis by oral administration. M.S. thesis. Huazhong Agricultural University, Wuhan, Hubei, China. (in Chinese).
Qin, C-J, Tu, SJ, Wu, YY, Yang, ZS and Chen, CF 2006. Fritillaria thumbergii: a new host of Lily mottle virus in China. J. Nat. Sci. Heilongjiang Univ 23:774-778 (in Chinese).
Roossinck, MJ, Martin, DP and Roumagnac, P 2015. Plant virus metagenomics: advances in virus discovery. Phytopathology 105:716-727.
crossref pmid
Santala, J and Valkonen, J 2018. Sensitivity of small RNA-based detection of plant viruses. Front. Microbiol 9:939.
crossref pmid pmc
Singh, K, Jarošová, J, Fousek, J, Chen, H and Kundu, JK 2020. Virome identification in wheat in the Czech Republic using small RNA deep sequencing. J. Integr. Agric 19:1825-1833.
crossref
Song, Z, Li, Z-A, Liu, K-H and Zhou, C-Y 2015. Complete genome sequence analysis of two Citrus tatter leaf virus (CTLV) isolates from China. J. Integr. Agric 14:984-987.
crossref
Tatineni, S, Afunian, MR, Hilf, ME, Gowda, S, Dawson, WO and Garnsey, SM 2009. Molecular characterization of Citrus tatter leaf virus historically associated with Meyer lemon trees: complete genome sequence and development of biologically active in vitro transcripts. Phytopathology 99:423-431.
crossref pmid
Xu, WB and Li, JX 1999. Preliminary analysis on the quality of introduced Fritillaria thunbergii Miq var chekiangensis . Lishizhen Med. Mater. Med. Res 10:1-6 (in Chinese).
Wang, J, Chen, XY, Lai, ZL and Zhang, YY 2013. Clinical observation on effects of adjuvant chemotherapy with fritillary Thunbergii bulb complex granules on symptoms of refractory acute leukemia patients. J. Beijing Chin. Med. Univ 32:833-835 (in Chinese).
Wei, CB, Chen, J, Zhang, QY, Shi, YH, Lin, L, Zheng, HY, Adams, MJ and Chen, JP 2005. A new potyvirus from Thunberg fritillary (Fritillaria thunbergii Miq.) in Zhejiang, China. Arch. Virol 150:1271-1280.
crossref pmid pdf
Wu, JL, Zhang, XB, Hu, J, Li, M, Jing, ZX, Yuan, Q, Li, SQ and Zhang, CC 2021. Quality of Fritillaria thumbergii Miq. Regionalization based on compositional content and ecological factors. J. Zhejiang Chin. Med. Univ 45:835-841 (in Chinese).
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 4,981 View
  • 130 Download
ORCID iDs

Jun-min Li
https://orcid.org/0000-0001-8244-0461

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next