Arabidopsis MORC1 and MED9 Interact to Regulate Defense Gene Expression and Plant Fitness
Article information
Abstract
Arabidopsis MORC1 (Microrchidia) is required for multiple levels of immunity. We identified 14 MORC1-interacting proteins (MIPs) via yeast two-hybrid screening, eight of which have confirmed or putative nuclear-associated functions. While a few MIP mutants displayed altered bacterial resistance, MIP13 was unusual. The MIP13 mutant was susceptible to Pseudomonas syringae, but when combined with morc1/2, it regained wild-type resistance; notably, morc1/2 is susceptible to the same pathogen. MIP13 encodes MED9, a mediator complex component that interfaces with RNA polymerase II and transcription factors. Expression analysis of defense genes PR1, PR2, and PR5 in response to avirulent P. syringae revealed that morc1/2 med9 expressed these genes in a slow but sustained manner, unlike its lower-order mutants. This expression pattern may explain the restored resistance and suggests that the interplay of MORC1/2 and MED9 might be important in curbing defense responses to maintain fitness. Indeed, repeated challenges with avirulent P. syringae triggered significant growth inhibition in morc1/2 med9, indicating that MED9 and MORC1 may play an important role in balancing defense and growth. Furthermore, the in planta interaction of MED9 and MORC1 occurred 24 h, not 6 h, post-infection, suggesting that the interaction functions late in the defense signaling. Our study reveals a complex interplay between MORC1 and MED9 in maintaining an optimal balance between defense and growth in Arabidopsis.
Plants have evolved an innate immune system against pathogens (Chisholm et al., 2006; Jones and Dangl, 2006). The perception of pathogen-associated molecular patterns (PAMPs) initiates the first line of defense, PAMP-triggered immunity (PTI) (Jones and Dangl, 2006; Zipfel and Felix, 2005). To counteract PTI, pathogens secrete effectors, leading to effector-triggered susceptibility. In response, plants have developed effector-triggered immunity (ETI), where resistance (R) proteins recognize effectors, triggering a stronger defense response (Chisholm et al., 2006; Jones and Dangl, 2006). ETI involves programmed cell death (hypersensitive response), calcium flux, oxidative burst, and transcriptional reprogramming (Hammond-Kosack and Jones, 1996). Many R proteins contain nucleotide-binding sites and leucine-rich repeats domains (Chisholm et al., 2006). Although ETI is stronger than PTI, the difference is mostly quantitative, involving similar defense genes (Tao et al., 2003; Tsuda et al., 2009), suggesting that R proteins amplify common defense signaling in ETI and PTI upon effector recognition (Ngou et al., 2021).
Most ecotypes of Arabidopsis are susceptible to Turnip crinkle virus (TCV) except for Di-17 (Dempsey et al., 1997). CRT1 (Compromised Recognition to TCV-CP 1) was identified in a screen for mutants that fail to develop hypersensitive response against the coat protein of TCV (Kang et al., 2008). It was later renamed MORC1 as it belongs to the microrchidia (MORC) protein family (Koch et al., 2017). MORC1 and its homolog, MORC6, are required for epigenetic gene silencing, as evidenced by the de-repression of silenced reporter genes and transposable elements (TEs) in morc1 and morc6 mutants (Brabbs et al., 2013; Lorkovic et al., 2012; Moissiard et al., 2012). MORC1 and its closest homolog, MORC2, are essential for PTI, ETI, basal resistance, non-host resistance, and systemic acquired resistance (Kang et al., 2008, 2010, 2012). MORC1 physically associates with numerous immune components, including at least 12 R proteins and the PAMP recognition receptor FLS2. Intriguingly, MORC1 increases in the nucleus upon the activation of PTI and ETI, suggesting that its nuclear function may be crucial in defense responses (Kang et al., 2012).
MORC proteins are chromatin remodeling factors, and contain GHKL ATPase and CW histone recognition domains (Hoppmann et al., 2011; Iyer et al., 2008). They bind nucleic acids and exhibit Mn2+-dependent endonuclease and ATPase activity (Kang et al., 2008, 2012). MORC proteins regulate chromatin compaction and directly compact DNA (Kim et al., 2019), essential for heterochromatin maintenance. This topology-associated function explains MORC1’s role in suppressing hypermethylated genes and TEs (Moissiard et al., 2012) and modulating physical accessibility to TEs near defense-related genes (Bordiya et al., 2016). However, the timing and mechanism of this physical topology’s importance in defense genes remains unknown.
The mediator (MED) complex, a large and multi-subunit RNA polymerase II-associated transcriptional regulator, coordinates various aspects of transcription and acts as a docking site for nuclear machinery (An and Mou, 2013; Buendía-Monreal and Gillmor, 2016; Conaway and Conaway, 2011; Kelleher et al., 1990; Samanta and Thakur, 2015a). It consists of four distinct modules: head, middle, tail, and cyclin-dependent kinase, each with specific roles in transcriptional regulation. In Arabidopsis, the MED complex is involved in the development and modulation of biotic and abiotic stresses (Malik et al., 2017). Extensive evidence demonstrates its importance in plant resistance to various pathogens, with genetic mutants of MED subunits displaying altered resistance and changes in defense-related genes. Examples include MED5a/b in phenylpropanoid pathways (Bonawitz et al., 2014), MED8 in jasmonic acid (JA) and salicylic acid (SA)-dependent defense (Kidd et al., 2011; Zhang et al., 2012), MED14 and MED15 in SA-induced resistance (Zhang et al., 2013), MED16 in basal resistance (Wang et al., 2015), MED18 in JA/ethylene (ET) signaling (Fallath et al., 2017), MED19 in JA-responsive genes (Caillaud et al., 2013), MED21 in susceptibility to necrotrophic fungi (Dhawan et al., 2009), and MED25 in JA-responsive defense and herbivore genes (Chen et al., 2012; Kidd et al., 2009). These findings highlight the role of the MED complex in coordinating transcription factors and RNA polymerase II during the massive transcriptional reprogramming required for plant defense responses (An and Mou, 2013; Yang et al., 2016).
Mounting a defense response comes with a fitness cost, which often manifests as a reduction in growth and reproduction. This trade-off carries critical implications for agricultural populations (Karasov et al., 2017). Intriguingly, growth-defense trade-offs can be decoupled under specific conditions, suggesting that the fitness cost can be minimized while maintaining adequate defense responses (Burdon and Thrall, 2003; Campos et al., 2016; van Hulten et al., 2006). Hormones such as gibberellins, SA, and JA play crucial roles in modulating the growth-immunity balance (Daviere and Achard, 2013; Gangappa et al., 2017; Navarro et al., 2008; Sun et al., 2011; Wang et al., 2015). Given the involvement of chromatin remodeling factors and transcriptional regulators in plant defense responses, it is plausible that these components also contribute to balancing growth and immunity.
In this study, we searched for MORC1 interacting proteins (MIPs) and further focused on one: MED9, a subunit of the MED complex, because of the unexpected disease resistance phenotypes of the combined mutant, morc1/2 med9. We attribute this unexpected gain of resistance to the inability to curb defense responses when MORC1 and MED9 are compromised. The physical interaction between MORC1 and MED9 observed at later stages of infection is also in line with this hypothesis, suggesting that the MORC1 and MED9 interaction is likely important in balancing defense and growth responses in Arabidopsis.
Materials and Methods
DNA constructs
The yeast two-hybrid constructs received from Hybrigenics Services (Evry-Courcouronne, France) were used to switch the prey and the bait clones by using SfiI restriction sites to validate the MORC1-MIP interaction. Genomic MED9 amplified from BAC T7N22 was digested with XhoI and ligated into the pBKS plasmid to generate pBKS-gMED9. A Flag-tag was introduced into pBKS-gMED9 using Cas9 Nuclease from New England Biolabs (NEB, Ipswhich, MA, USA) to create pBSK-gMED9-Flag. The gMED9-Flag fragment was then excised using XhoI and ligated into the pPZP-RCS2-hptII vector using SalI to generate pPZP-gMED9-Flag. The pER8-Myc-MORC1 construct was described previously (Kang et al., 2012). The coding sequence of the MIP genes were cloned into pER8 tagged at the 3′ end with triple HA (pET-HA) by using AscI sites and transformed into Agrobacterium tumefaciens strain GV2260 using electroporation.
Yeast two-hybrids
pB27 bait and pP6 prey plasmids were transformed into Y187 and L40 yeast strains, respectively. This yeast two-hybrid system uses the HIS3 reporter gene, which encodes imidazoleglycerol-phosphate dehydratase, an enzyme required for the synthesis of the amino acid histidine (His). In the yeast two-hybrid system, the interaction between the bait and prey proteins leads to the reconstitution of a functional transcription factor, which activates the expression of the HIS3 reporter gene. Minimal media containing His was used to demonstrate growth, while media lacking His was used to test the interaction between the prey and bait proteins. A competitive inhibitor of His synthesis, 3-amino-1,2,4-triazole (3-AT), was used to evaluate the strength of the interaction. A stronger interaction leads to higher HIS3 expression, which can outcompete 3-AT. A concentration of 0.1 mM 3-AT was used to create a stringent condition for selecting strong interactions.
Transient expression in Nicotiana benthamiana
The growing of the Agrobacterium culture and its infiltration process were performed as described (Menke et al., 2005). pBA-HcPro was used to suppress gene silencing to maximize the transient expression. A solution of 30 μM estradiol in 0.1% Tween-20 was sprayed on the leaves to induce the expression of pER8-based constructs at 1-day post-infiltration. These plants were then grown for an additional 2 days at room temperature.
Immunoblotting analysis
Immunoblotting analysis was performed as described using an enhanced chemiluminescence method (Kang and Klessig, 2005). Tissue samples in 2 ml tubes were ground with a ceramic bead with 4× sodium dodecyl sulfate (SDS) sample buffer containing dithiothreitol (DTT) at 60 mg/ml using a homogenizer. Once homogenized, these samples were boiled for 5 min and centrifuged at 21,100 ×g for 1 min. Five microliters of supernatant was loaded into sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane (Immobilon, Millipore, Billerica, MA, USA) using a standard transfer buffer. The rest of the immunoblotting analysis was performed as previously described (Kang and Klessig, 2005) with the following differences: ECL2 solution (Thermo Fisher Scientific, Waltham, MA, USA) was used to detect the antibodies, and the membrane was imaged using an Azure Biosystems C600 imager (Dublin, CA, USA). Antibodies used include HRP-conjugated anti-Myc (1:5,000, Santa Cruz Biotechnology, Santa Cruz, CA, USA), HRP-conjugated anti-FLAG (1:5,000, Sigma, St. Louis, MO, USA), and HRP-conjugated anti-HA (1:10,000, Sigma).
Co-immunoprecipitation
Leaves of Arabidopsis or N. benthamiana were homogenized with a mortar and pestle in liquid nitrogen. Samples were ground again in 750 μl of extraction buffer (GTEN buffer: 150 mM NaCl, 1 mM EDTA, 25 mM Tris pH 7.5, and 10% glycerol) with 2% polyvinylpolypyrrolidone, 1× protease inhibitor cocktail (Sigma), and 0.1% Triton X-100. These protein extracts were collected and centrifuged at 5,000 ×g at 4°C for 5 min, and 0.5 ml of the supernatant was then subjected to size exclusion chromatography using Illustra NAP-5 Sephadex G-25 DNA grade columns (GE Healthcare, Pittsburgh, PA, USA) to remove salts and perform buffer exchange. Eluates were collected in 1.5 ml tubes, mixed with 20 μl of anti-mouse IgG agarose beads (Sigma), and incubated at 4°C for 2 h with gentle rotation. After removing the anti-mouse IgG agarose beads, the remaining solutions were mixed with 20 μl of agarose beads conjugated with a target antibody and incubated at 4°C overnight. These solutions were washed a minimum of six times with 1 ml of IP buffer (GTEN buffer with 0.15% NP-40 and 5 mM DTT) and mixed with 30 μl of 4× SDS sample buffer before proceeding to immunoblotting analysis.
Imaging-based and conventional leaf-disc-based resistance assay
Three point five-week-old Arabidopsis plants were syringe-infiltrated with an indicated inoculum of Pseudomonas syringae pv. tomato DC3000 (Pst) grown for 2 days at 28°C in King’s B medium with appropriate antibiotics. Imaging-based resistance assays were performed as previously described (Pujara et al., 2021) except that Pst carrying the luxCDABE operon was used.
For a conventional leaf-disc-based resistance assay in Arabidopsis, three leaf disks were collected into a single 2 ml tube and homogenized using a homogenizer for 1 min in 500 μl of 0.01% Triton X-100. The samples were incubated on a mild rotating shaker for 10 min and then homogenized again in the shaker for 1 min. Samples were vortexed briefly and serially diluted. Twenty microliters of all dilutions were then plated on Luria-Bertani, and colonies were counted after 36 h.
Fitness cost test
Three point five weeks after germination, two leaves from each plant were infected with Pst carrying AvrRpt2 at 1 × 105 cfu/ml every 2 days for 3 weeks. Upon completion of the treatment, plants were imaged to check the growth and development characteristics.
RNA preparation, cDNA synthesis, and quantitative reverse transcription PCR analysis
Two leaves were generally collected in a single tube and homogenized in a shaker for 1 min using a bead. Their RNA was extracted using the Purelink RNA Mini kit 250 (Thermo Fisher Scientific). For quantification, RNA was converted to cDNA using SuperScript RT (Invitrogen, Carlsbad, CA, USA). The primers used in reverse transcription PCR are as follows: PR1-For (AAAACTTAGCCTGGGGTAGCGG), PR1-Rev (CCACCATTGTTACACCTCACTTT), PR2-For (ATCAAGGAGCTTAGCCTCAC), PR2-Rev (TGTAAAGAGCCACAACGTCC), PR5-For (CTCTTCCTCGTGTTCACTCAC), PR5-Rev (GAAGCACCTGGAGTCAATTC), Tip41-Like-For (GCGATTTTGGCTGAGAGTTGAT), and Tip41-Like-Rev (GGATACCCTTTCGCAGATAGAGAC). Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific) was used for quantitative reverse transcription PCR (qRT-PCR). PCR was performed with the following temperature/time profile: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 25 s and 60°C for 1 min.
Genetic resources
Generation of Myc-gCRT1 transgenic line is as described (Kang et al., 2012). med9 was tranformed with pPZP-gMED9-Flag and subsequentely crossed with Myc-gCRT1 line to generate Myc-gCRT1 gMED9-Flag in morc1/2 med9. The following mutant lines were obtained from The Arabidopsis Information Resource (TAIR): cpl3 (c-terminal phosphatase-like3, med4), SALK 051322; GNARLED (med5), SALK 014298; smc1 (structural maintenance of chromosomes1, mip8), CS87452; a trihelix transcription factor (mip9), SALK 024424; bzip29 (basic leucine zipper29, mip10), SALK 018426; a mobile domain protein (med12), SALK 066042; med9 (med13), SALK 029120.
Plants growth
Plants were grown in soil in a growth chamber under long-day photoperiod (16 h light, 12k lux of cool white fluorescence bulbs) at 23°C, 60% relative humidity.
Results
A yeast two-hybrid screening identified 14 MORC1 interaction proteins
A conventional yeast two-hybrid (Y2H) screening for MORC1 as a bait was performed by Hybrigenics using 87 million prey clones. The commercial service provided 14 confirmed clones that interacted with the bait, which are listed in Table 1. To validate the physical interaction between MORC1 and its interacting proteins, MIPs, we generated a targeted Y2H assay with the bait and prey vectors for MORC1 and all 14 MIPs, respectively (Fig. 1). In addition, we also generated constructs that switched the bait and the prey. MORC1, when used as bait, interacted with all the MIP clones identified in the screen, confirming the outcome provided by Hybrigenics, while MIP6 displayed autoactivation. MORC1 showed a weak interaction with itself, suggesting homodimerization. When MORC1 was switched to prey (pP6-MORC1), it interacted with a subset of the MIPs: MIP2, MIP3, MIP7, MIP11, and MIP12 (Fig. 1). When a transcription-activating domain is present in a bait vector, it generally activates without a prey vector. This transactivation was observed with MIP6 and MIP13, and to a lesser degree, with MIP7, suggesting that these MIP proteins may carry a transactivation domain. As previously stated, MIP13 (MED9) is part of the MED complex that interfaces a transcription factor with RNA polymerase II (Allen and Taatjes, 2015; Buendía-Monreal and Gillmor, 2016; Kidd et al., 2011). Thus, when used as bait, MIP13 appears to function as a coactivator and brings in a factor(s) with transactivation activity. There were several interactions shown across MIPs. MIP11, a sorting nexin (Phan et al., 2008), interacted with the highest number of MIPs, including MIP2, MIP11, MIP12, MIP13, and MIP14 (Fig. 1). MIP3 is a MORC1 homolog, MORC6. The interaction between MORC1 and MORC6 was previously reported (Liu et al., 2014), and their heterodimer was shown to maintain heterochromatin compaction (Moissiard et al., 2012). Interestingly, MORC6 did not interact with any of the MIPs, suggesting that the MIPs are likely specific to MORC1.
In planta interactions of MORC1 with MIPs in Nicotiana benthamiana
The MIP proteins were further examined to determine if the interaction occurs with MORC1 in planta. To this end, we transiently co-expressed MIPs and MORC1 tagged with HA and Myc, respectively, in N. benthamiana. The expressed proteins were subjected to a co-immunoprecipitation (co-IP) experiment in which an αHA antibody immunoprecipitated MIP proteins, and its co-IP of MORC1 was monitored by western analysis with an αMyc antibody. MIP4, MIP6, MIP7, MIP8, and MIP12 were not detectable via HA immunoblotting analysis (Fig. 2). MIP3 and MIP13 co-immunoprecipitated significantly more MORC1 than other weak interactors such as MIP9, MIP10, and MIP11 (Fig. 2). Note that MORC1 is known to be expressed as doublets, with the higher band suspected to result from post-translational modifications (Kang et al., 2012).
Some MIPs are involved in bacterial resistance in Arabidopsis
Eight T-DNA insertion mutants for selected MIPs with annotated nuclear localization, similar to MORC1, were obtained from TAIR. We used an image-based resistance assay involving Pst carrying the luminescent luxCDABE reporter gene (Fan et al., 2008) to analyze the disease resistance phenotypes in a high-throughput manner. We used virulent Pst (VirPst) for infection, which provided the resistance phenotypes for basal resistance. mip3, mip10, and mip13 were susceptible against VirPst, while mip4 and mip9 were resistant (Fig. 3). mip8, due to a homozygous lethality, was not further characterized.
med9 mutant showed reduced resistance, but combining it with morc1/2 restored resistance
We showed that a knock-out mutant of MED9 displayed compromised resistance to VirPst (Fig. 3). As we have used an imaging-based assay, we suspected the magnitude of altered resistance could have been underestimated. Thus, we performed a conventional leaf-disc method to assess bacterial resistance in med9, morc1/2, and their higher-order mutant (morc1/2 med9).
The single mutants, med9 and morc1/2, were susceptible to VirPst and avirulent Pst (AvrPst), suggesting that these components are involved in basal resistance and ETI. Unusually, morc1/2 med9 regained WT-level resistance through an unknown mechanism (Fig. 4). Restoring resistance by combining two susceptible mutants is counterintuitive, which indicates that the MORC1 and MED9 interaction is likely multifaceted, perhaps involving various differential gene regulations over time. For instance, these factors may be essential in inducing defense genes early, while more engaged in curbing the induced genes later to minimize unnecessary fitness costs.
Transcriptional analysis of select defense genes to track defense signaling in MED9-associated genetic lines
We further characterized MED9 by tracking the expression of defense genes in med9 and morc1/2 med9 together with morc1/2 in response to AvrPst and VirPst infection. We chose three well-characterized defense genes for our targeted transcriptional analysis: PR1, PR2, and PR5 (Shah et al., 1997). Transcription dynamics of defense genes are also known to be an important predictor for successful resistance. For instance, PR1 induction was delayed in morc1/2 when examined at multiple time points (Bordiya et al., 2016) which explains the susceptible resistance phenotype against AvrPst and VirPst. Thus, we decided to use the same multiple time points for our transcriptional analysis: 0, 1, 6, 24, and 48 hpi (hours post-infection).
qRT-PCR analysis was carried out for quantitative transcriptional analysis of PR1, PR2, and PR5 in response to infection with AvrPst and VirPst; mock infection was used as a negative control. PR1 was induced similarly in response to AvrPst among WT, med9, and morc1/2 (Fig. 5A). However, the induction of PR1 was slow (see 24 hpi with AvrPst in Fig. 5A) and trended upward even at 48 hpi in morc1/2 med9. This upward trend, while to a lesser degree, was seen with PR2 and PR5 at 48 hpi in med9 and morc1/2. While it was less obvious than those responding to AvrPst, the induction rate of all the defense genes from 24 hpi to 48 hpi was steepest in morc1/2 med9 responding to VirPst. Induction of PR2 and PR5 in med9 and morc1/2 was less robust and rapid relative to WT (Fig. 5B and C), consistent with their susceptible phenotypes to AvrPst and VirPst.
MED9 interaction with MORC1 occurred at later times in Arabidopsis
Physical MORC1-MED9 interaction was established in the Y2H assay (Fig. 1). As MORC1 displays nucleus-translocation in response to biotic stress (Kang et al., 2012), it is feasible that the MORC1-MED9 interaction depends on stress. To test this possibility, a transgenic Arabidopsis line carrying Myc-MORC1 and MED9-Flag under their cognate promoters was subjected to a co-IP experiment, which confirmed physical interaction of the two proteins (Fig. 2). The MORC1-MED9 interaction was further investigated by monitoring levels of PR1, PR2, and PR5 at 6 and 24 hpi with AvrPst treatments (Fig. 6) using co-IP, in which MORC1 was precipitated and MED9 was examined for co-IP. The results demonstrated that AvrPst significantly increased the MORC1-MED9 interaction at 24 hpi. In response to AvrPst, over 99% of the inducible defense genes in Arabidopsis peak at around 6 hpi and begin curbing this induced expression at 24 hpi (Mine et al., 2018). Note that three PR genes that display a 24-h peak are rather the exceptions than the rule in an overall group of genes showing a dynamic induction pattern (Mine et al., 2018). Given the kinetics of the defense gene induction, it is unlikely that MED9 interacts with MORC1 to enhance transcription. Instead, it is conceivable that MED9 interacts with MORC1 to restrain the overexpression of defense genes. Since MED14 interacts with a co-repressor LUG to facilitate target gene repression in Arabidopsis (Gonzalez et al., 2007), MED9 could also coordinate with MORC1 to repress defense genes at later time points.
Fitness cost assessed by repeated pathogen challenges
We observed that morc1/2 and med9 displayed compromised resistance to AvrPst and VirPst, while morc1/2 med9 regained WT-level resistance (Fig. 4). We further investigated this seemingly counterintuitive observation by tracking three commonly used defense genes (PR1, PR2, and PR5) to obtain a snapshot of defense signaling; this investigation revealed the slow but sustained expression of defense genes in morc1/2 med9. While regaining bacterial resistance to the level of WT through extended expression is likely beneficial to the host, it is frequently observed that excessive resistance incurs fitness-costs (Huot et al., 2014). Therefore, we hypothesized that regaining resistance in morc1/2 med9 likely incurs a fitness-penalty.
We observed little difference in the morphology of morc1/2, med9, and morc1/2 med9 at 3.5 weeks after germination relative to WT, as shown in the upper panel of Fig. 7A. These plants were then repeatedly infected with AvrPst at 1 × 105 cfu/ml every other day for 3 weeks and evaluated for their growth characteristics (Fig. 7B and C). First, the total weight was significantly reduced for morc1/2 med9 when repeatedly challenged with AvrPst (Fig. 7B). We further characterized their growth and fertility characteristics: the weight and number of leaves, the weight and number of inflorescences, and the number of siliques (the long and narrow seedpods in Arabidopsis). Remarkably, only morc1/2 med9 plants showed a significant reduction in all five measurements in response to AvrPst infection relative to the mock control (Fig. 7C), indicating a severe fitness cost incurred due to recurrent infection. For instance, the total leaf weight of morc1/2 med9 was reduced by over 25% in response to AvrPst infection, while those of WT and the single mutants showed negligible changes. In particular, siliques of morc1/2 med9 were significantly reduced in number, suggesting that sexual reproduction was also affected as a part of the fitness penalty.
Discussion
We identified 14 proteins interacting with MORC1 via Y2H screening, eight of which were predicted to be nuclear-localized and putative chromatin remodeling components. Among these, MED9, a member of the mediator complex that interfaces between transcription factors and RNA polymerase II (Samanta and Thakur, 2015a, 2015b), was identified. MED9 appears to be a positive regulator of plant defense signaling. Like MORC1, its loss led to compromised resistance to Pst.
Counterintuitively, a combined mutant, morc1/2 med9 regained WT-level bacterial resistance, suggesting a complex genetic interaction, which are often reported. For example, in a study on leaf sucrose content, the mex1 phs1b double mutant exhibited significantly lower levels compared to each respective single mutant, which showed higher levels than WT (Malinova et al., 2014). Similarly, while nhx1 or nhx2 single mutants develop flowers similar to or even longer than WT, the nhx1 nhx2 double mutant, in contrast, exhibits shorter flower lengths (Bassil et al., 2011). These examples highlight the intricacy of genetic interactions and raise the question: how is morc1/2 med9, whose single mutants display compromised bacterial resistance, regaining WT-level resistance?
To address this question, we first measured the timing of the physical interaction between MORC1 and MED9 in planta and found the interaction enhanced at 24 hpi with AvrPst, not at 6 hpi. This later interaction suggests that the role of this interplay likely lies in later defense signaling (Fig. 6). A multi-point transcription study also indicates that induction of most defense genes under ETI peaks around 6 hpi, and most defense genes display downregulation by 24 hpi (Mine et al., 2018), suggesting that 24 hpi is likely a late time point for ETI. From this, we inferred that the MORC1-MED9 interaction functions to slow down the induced defense genes. In line with this inference, when we tracked the transcription dynamics of the defense genes at multiple time points responding to AvrPst, morc1/2 med9 displayed sluggish but sustained expression of late defense genes, particularly PR1, that mainly peak at 24 hpi with AvrPst. This sustained expression pattern, which may explain how WT-level resistance was restored in morc1/2 med9, also pointed to the possibility that MORC1-MED9 interplay is important in late defense signaling, where transcriptional suppression becomes more dominant.
Heterochromatin is often associated with DNA methylation, and is typically marked by H3K9 methylation (H3K9me). In plants, the first identified H3K9 methyltransferase, KRYPTONITE (KYP)/SU(VAR)3–9 homolog 4 (SUVH4), functions partially redundantly with SUVH5 and SUVH6 to catalyze H3K9me (Ebbs and Bender, 2006; Jackson et al., 2002; Zhang et al., 2023). SUVH4/5/6 represses the expression of R genes and downstream defense-related genes, with the suvh4 suvh5 suvh6 triple mutant exhibiting enhanced resistance to Pst (Cambiagno et al., 2021). IBM1, a major H3K9 demethylase in Arabidopsis, activates defense genes such as PR1 and PR2, and ibm1 mutants are hyper-susceptible to Pst (Chan and Zimmerli, 2019).
Given these observations, it is tempting to speculate that while MED9 mediates transcriptional activities, MORC1 could function to silence defense genes through chromatin compaction. This hypothesis is supported by the finding that Caenorhabditis elegans MORC1 compacts DNA (Kim et al., 2019). However, this idea seems counterintuitive, as MORC1 has been shown to be a positive regulator of ETI, with the loss of MORC1 and its homolog leading to the suppression of ETI (Kang et al., 2008, 2010). This suggests that MORC1 may have an additional function in early defense signaling that remains to be characterized.
The fitness cost of sustained PR gene expression and their associated defense signaling in morc1/2 med9, which resulted in restored WT-level resistance, became evident when the plants were repeatedly challenged with AvrPst. While there was little to no effect on those of WT, med9, and morc1/2, extended biotic stress triggered a significant reduction in the growth and reproduction of morc1/2 med9 (Fig. 7), highlighting the importance of properly curbing defense signaling in time. Since fitness-costs of ETI were first reported in Arabidopsis (Tian et al., 2003), several signaling pathways have been reported to affect ETI-associated fitness costs (Richard et al., 2018). For instance, there is cross-talk and counter-regulation between the growth-related hormones including auxin, brassinosteroids, cytokinins, and gibberellins, and the defense-related ones including SA, ET, and JA (He et al., 2022). In addition, photosynthesis and its related genes are downregulated in response to AvrPst and VirPst (Bonfig et al., 2006). These growth-related components and their misregulation in response to bacterial infection could well be the reason why morc1/2 med9 displayed notable fitness costs.
In this study, we identified 14 MIPs and characterized a genetic interaction between MED9 and MORC1. We found that sustained expression of the PR genes in morc1/2 med9 restored resistance but incurred fitness penalties. This outcome may suggest that MORC1 is involved in downregulating induced defense genes once immune responses are concluded, highlighting the importance of properly regulating biotic stress in a plant’s fitness.
Notes
Conflicts of Interest
No potential conflict of interest relevant to this article was reported.
Acknowledgments
We thank Nicole Beisel for her assistance in constructing the clone, and to Angela Kang for reviewing the manuscript. This work was supported by the National Science Foundation (IOS-1553613, H.K).