Plant Pathol J > Volume 41(3); 2025 > Article
Zhang, Jia, Han, Cheng, Jiao, Fan, Ren, Ren, Cai, Zhang, Li, Pang, and Shang: Comparison of Tomato Yellow Leaf Curl Virus-Induced Gene Expression Pattern in Tomato and Tobacco Plants

Abstract

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen that causes substantial yield losses, and this virus can infect both tomatoes (Solanum lycopersicum L.) and tobacco (Nicotiana benthamiana). In this study, a constructed infectious clone of TYLCV was used for the exploration of tomato and tobacco plants’ response to virus infection. Infected plants exhibit typical symptoms of TYLCV, including leaf chlorosis, curling, and plant dwarfing. Reactive oxygen species accumulated, and severe cell necrosis appeared in the tomatoes and tobacco that were infected. After TYLCV infection, 6,775 and 900 genes’ expressions were up-regulated in tomatoes and tobacco, including MYB and MADS-box transcription factors, serine/threonine protein kinase, heat shock proteins, cytochrome P450s, E3 ubiquitin-protein ligase, RAV transcription factors. Several stress-responsive kinases involved in autophagy were significantly up-regulated in tobacco but not in tomato. Moreover, silencing the RAV transcription factor, which is associated with the salicylic acid induced antiviral signaling, led to decreased virus abundance in tomato leaves. The results are helpful for an in-depth understanding of plants’ resistance to TYLCV infection.

Tomato (Solanum lycopersicum L.) is a valuable vegetable and fruit plant. Among biotic and abiotic stresses that impede tomato growth, viral infection is the most challenging to control (Wu et al., 2006), seriously destroying tomatoes’ growth, yield, and quality (Cao et al., 2024). Among the pathogenic viruses affecting tomatoes are the tomato yellow leaf curl virus (TYLCV), the tomato mosaic virus (ToMV), the tomato chlorosis virus (ToCV), and over 20 other types of viruses (Prasad et al., 2020). Notably, TYLCV is a particularly devastating pathogen of tomatoes, which causes substantial losses of yields in numerous tropical and subtropical regions. TYLCV is a member of the Geminiviridae family and the Begomovirus genus. Geminiviruses are DNA plant viruses that cause highly damaging diseases that affect crops (Péréfarres et al., 2012). During the infection process, geminiviruses hijack cellular processes, suppress plant defenses, and cause a massive reprogramming of the infected cells, which leads to significant changes in the homeostasis of the whole plant (Romero-Rodríguez et al., 2023). In the early stages of infection, the leaves become chlorotic and curl; the new leaves shrink, the entire plant ceases to grow, the flowers wilt, and the rate of fruit setting declines, leading to significant economic losses for the tomato industry (Moriones and Navas-Castillo, 2000). The current methods for preventing and controlling TYLCV mainly involve using tomato varieties resistant to the virus, along with biological, chemical, and/or physical control measures for cultivation and management to resist transmission by whitefly vectors (Liu et al., 2021; Wei et al., 2024). Mutations in the virus, combined with agricultural practices, can still result in the reinfection of tomato plants, rendering chemical treatments ineffective. Preventing TYLCV faces substantial challenges, leading to its widespread occurrence globally. Therefore, urgent action is needed to implement additional prevention and control measures.
As early as the 1860s, TYLCV was identified in Israel. By the late 20th century, it had spread globally due to weather patterns and the expansion of international trade, particularly through the TYLCV-Mld and TYLCV-IL strains, as noted by Péréfarres et al. (2012). Tomato yellow leaf curl disease (TYLCD) was reported in Sunqiao, Shanghai, China, in March 2006, with a 90% incidence rate among tomato plants (Wu et al., 2006). Currently, TYLCV has become widespread in China, causing substantial damage to the domestic tomato industry (Chen et al., 2024; Wu et al., 2006). The TYLCV genome consists of 2.7-2.8 kb of circular single-stranded DNA and exhibits a high rate of genetic recombination and variation (Zhou et al., 2003). There are more than 100 known full-length sequences of TYLCV, including TYLCV-BJ (GenBank: MN432609.1), TYLCV-SDWF-L7 (GenBank: KC999850.1), TYLCV-SDSGMT (GenBank: KC999847.1), TYLCV-SDSGGC-1 (GenBank: KC999846.1), TYLCV-SDZi (GenBank: KC852151.1), TYLCV-YN4392 (GenBank: KU934104.1), and TYLCV-SDSGDT (GenBank: KC999844.1). These sequences exhibit over 98% homology, with mutations typically concentrated at the beginning of the sequence, including point mutations within the reading frame. Most sequences in the reading frame are relatively conserved.
There is relatively advanced research on the pathogenicity of diverse proteins encoded by TYLCV; these proteins may affect the level of endogenous gene expression in plants through recognition, interaction, and regulation. The TYLCV genome sequence includes six open reading frames, which are virus capsid proteins CP (V1) and V2, along with the complementary sense-encoded proteins C1, C2, C3, and C4. These proteins are essential for the virus’ replication, movement, and other related processes. CP acts as the pathogenic factor and is the only structural protein responsible for the virus’ systemic infection and viral packaging (Wartig et al., 1997; Zhao et al., 2020). V2 has been identified as an RNA-silencing suppressor (RSS) and a pathogenic protein of TYLCV (Czosnek et al., 2013). It has been shown that V2 can affect the stability and accumulation of effector proteins involved in the plant’s antiviral RNA silencing pathways. Additionally, it has the capability to identify various plant proteins associated with disease resistance (Bar-Ziv et al., 2015; Wang et al., 2018; Zhao et al., 2020). C1 is a protein involved in replication, while C2 serves as a transcription-activating protein and an RSS (Rosas-Diaz et al., 2023; Wartig et al., 1997). It can simultaneously inhibit post-transcriptional gene silencing by suppressing both transcriptional and post-transcriptional processes (Dong et al., 2003). C3 is a protein that enhances viral replication, whereas C4 is a viral protein that inhibits systemic silencing and is linked to proteins associated with viral movement (Zhao et al., 2022). The research shows that V2 interacts with proteins such as SGS3 (Glick et al., 2008) and GRXC6 (Zhao et al., 2021) associated with RNA silencing pathway. Additionally, C4 affects the expression of plant receptor-like kinases (Garnelo Gómez et al., 2019), while C2 interacts with JAZ proteins to influence the antiviral defense responses mediated by jasmonic acid (Ali et al., 2017). Furthermore, certain plant proteins linked to the plant’s anti-virus pathways may be closely related to viral proteins, influencing the plant’s resistance to viruses, including WRKY, NAC, LeHT1, bHLH, AP2/ERF transcription factors (TFs) (Eybishtz et al., 2009; Huang et al., 2016a, 2016b, 2017; Wang et al., 2015). Further research is needed to understand the complex relationship between plant viruses and their hosts. This understanding will help reveal the mechanisms involved and lead to strategies for preventing and controlling infections caused by these pathogens.
Infectious clones of viruses are essential research tools for analyzing viral biology and pathogenic mechanisms. Several infectious clones of TYLCV have already been constructed. Using TYLCV infectious clones, the pathogenicity of different isolates and the virus-plant interaction have been analyzed in Arabidopsis and tomato plants. Wu et al. (2006) constructed an infectious clone of TYLCV Shanghai 2 (TYLCV-SH2) based on TYLCV isolates found in Shanghai; it was the first report of TYLCV in China. Previous researchers have successfully infected Arabidopsis with the TYLCV-SH2, TYLCV-IL, and TYLCV-Mld strains using infectious cloning techniques, although no visible viral symptoms were detected (Cañizares et al., 2015; Wu et al., 2006). Gong et al. (2022) also constructed a TYLCV infectious clone that induced symptoms in tobacco and tomato plants. In 2022, Gong et al. developed an infectious clone of TYLCV-BJ with greater infection efficiency than its predecessors, causing symptoms 26 days post-virus infection. However, further research is needed on the construction of an infectious clone of TYLCV.
This study specifically focused on constructing more efficient infectious clones of TYLCV and examining how infection affects the endogenous expression of genes in tomato and tobacco plants, as analyzed through high-throughput RNA sequencing (RNA-seq). Additionally, we preliminarily revealed that some anti-virus genes in tomato plants may resist virus infection through targeted action. This study provides valuable information for further exploration of the pathogenic mechanisms of TYLCV and the defensive mechanisms of plants against its pathogen.

Materials and Methods

Materials

To amplify the entire genome sequence of TYLCV, tomato seedlings were acquired for infection with TYLCV in a greenhouse located in Shijiazhuang, Zhao County, China, in June 2023. The top leaves of the tomato plants (10-12 plants, with three repetitions) exhibited symptoms such as chlorosis, mottling, and curling, which were suspected to be caused by TYLCV. Fresh leaves from the top of the tomato seedlings were collected and stored at −80°C for further investigation of the pathogenic virus. To confirm the function of infectious cloning, virus-free tobacco (Nicotiana benthamiana) and tomato (Solanum lycopersicum cv. “Jinpeng No. 1”) seedlings, preserved in our laboratory, were used in this experiment. The tomato and tobacco seedlings were grown in an artificial climate chamber at 25/18°C (day/night), with a relative humidity of 60% and a light cycle of 16/8 h (light/dark). The tobacco plants were cultivated for 4 to 6 weeks, while the tomato plants were grown for 6 to 8 weeks.

Infectious clonal construction

To confirm virus species, the partial sequence of the TYLCV isolate was amplified from the materials mentioned in 2.1 using an Ezup cfDNA Extraction Kit and High Fidelity PCR Master Mix (Sangon, Shanghai, China) with degenerate primer pairs PA (5′-TAATATTACCKGWKGVCCSC-3′)/PB(5′-TGGACYTTRCAWGGBCCTTCACA-3′). Then, this sequence was cloned into a pMD19-T vector, transformed into Escherichia coli Trans5α, and sequenced.
For the whole genome sequence of TYLCV in tomato cloning, we amplified total DNA extracted from tomato leaves as a template, using primers (F1: ACCGGATG GCCGTGCCTTTT/R1: AATATTATACGGATGGCC GCTTTAATG). The PCR products (2,781 bp) were cloned into the pMD19-T vector, and the recombinant plasmid T-TYLCV was used as the template to construct the infectious clone of TYLCV. Subsequently, two fragments (Fig. 1), covering 0.4× viral genome sequence and full-length genome sequence, were amplified using the vector T-TYLCV as template with primer pair F2: GAATTCCTTGAAGTGCTTTAAA/R2: TGGATCCCACATAGTGCAAGA and F3: TGGGATCCACTTCTAAATGAATTTCC/R3: GGATCCCCCACATAGTGCAAGACAA. The EcoRI restriction site was added to the 0.4-fold segment by the primer, and the natural BamHI restriction site (There is a natural BamHI cleavage site in the virus sequence itself) was present on the two fragments, so these two fragments could be easily connected and constructed in the pCambia1300 vector (EcoRI/BamHI). Finally, a 1.4 copy of the TYLCV sequence was ligated with the pCambia1300 vector, which generated the TYLCV infectious clone designated TYLCV-SJZ2.0.
Our laboratory provided the Escherichia coli Trans5α, Agrobacterium tumefaciens GV3101, and the plant binary expression vector pCambia1300 plasmid for this experiment.

Infectious clonal inoculation

Rifampicin (Rif, 100 mg/L) and kanamycin (Kan, 50 mg/L) were added to Luria-Bertani media as screening antibiotics. The positive infectious clone plasmid was transformed into receptive Agrobacterium tumefaciens GV3101 and cultured to an optical density of 0.6 to 0.8 at 600 nm at 28°C. Agrobacterium cells were harvested by centrifugation and resuspended in the infiltration buffer (10 mM MES/NaOH, pH 5.6, 10 mM MgCl2, 150 μM acetosyringone). A 1 ml syringe was used to inoculate the undersides of tomato and tobacco leaves with the bacterial solution, while the Agrobacterium containing the empty vector pCambia1300 was used as the control group. Each leaf received an injection of 0.5 to 0.8 ml of the solution. Each experiment was repeated three times. After 10 to 15 days of inoculation, the tobacco and tomato seedlings were observed to determine whether symptoms appeared in the infiltrated and systemic leaves.

Plant DNA extraction, PCR, and real-time PCR

The DNA from tomato and tobacco leaves was extracted using an Ezup column-based super plant genome DNA extraction kit (Shanghai Biotech, Shanghai, China), as described by Wang et al. (2023). A NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA) was used to detect the content of DNA, and 1% agarose gel electrophoresis was used to detect the DNA quality. PCR was utilized to detect whether tomato and tobacco plants were infected with TYLCV with primers TYLCV-V2-F (5′-ATGCCTCGTTTATTTAAAC-3′)/TYLCV-V2-R (5′-TTACGCCTTATTGGTTTCTTC-3′). Real-time fluorescence quantitative PCR (RT-qPCR) experiments were conducted using a CFX96 fluorescence quantitative PCR instrument (Bio-Rad, Hercules, CA, USA) and a SYBR PrimeScript RT-PCR Kit (Nuoweizan, Nanjing, China) to analyze the level of accumulation of the virus particles and that of the related genes as described by Zhong et al. (2021). The primer used to analyze the level of accumulation of TYLCV was TYLCV-CP-q-F: TAATCATTTCCACGCCCGTCTC, TYLCV-CP-q-R: CAGTATGCTTAATATCATCCCGTTGCTC. After the amplification reaction, a melting curve was generated by gradually increasing the temperature while monitoring the fluorescence signal at each step. There is a characteristic peak on the melting temperature (Tm, the temperature at which DNA double-stranded breaks 50%), which can be used to distinguish specific viral sequences from other products, such as primer dimers, and to prove whether the virus successfully infected the plants.

Reactive oxygen species and 3,3′-diaminobenzidine staining

A volume of 0.1% 3,3′-diaminobenzidine (DAB) in 50 mM Tris-HCl (pH 3.8) was used to soak the leaves in a light incubator at room temperature for 6 to 8 h, after which the leaves were cleaned and boiled in 95% ethanol for 15 min. The leaves were then soaked in fresh 95% ethanol for 12 to 18 h until the chlorophyll had completely faded. Each assay was conducted independently in triplicate.

Cell death analysis and H2O2 detection

For trypan blue staining, the leaves were placed in the trypan blue (10 mL lactic acid, 10 mL glycerol, 10 mL phenol, 10 mL ddH2O, and 15 mg trypan blue staining solution) for 5 h after slight vacuum infiltration, rinsed with ddH2O and then boiled in 95% ethanol (v/v) for 10 min. Each assay was conducted independently in triplicate.

RNA-seq library preparation, sequencing, and data analysis

Shanghai Biotech (Shanghai) Co., Ltd. (Shanghai, China) was contracted to perform RNA extraction, library construction, and transcriptome sequencing. Leaves from tomato and tobacco plants inoculated with TYLCV and those from control groups served as the materials for the transcriptome analyses. Total RNA from the tomato and tobacco leaves was extracted using a Qubit RNA Extractor (TRIzol) RNA extraction kit (Shanghai Biotech), and RNA concentration was measured with Qubit 2.0 (Thermo Fisher Scientific). The mRNA 3′-terminal poly A structure and various molecular biology techniques, including mRNA isolation, fragmentation, double-stranded cDNA synthesis, cDNA fragmentation modification, magnetic bead purification, and library amplification, were employed on the total RNA from the tomato leaf samples. After quality inspection, transcriptome analysis was conducted using an Illumina HiSeq sequencing platform (Illumina, San Diego, CA, USA). The tomato SL4.0 genome was utilized as the reference genome for sequence alignment, and gene ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and differential gene function analyses were carried out on the resulting differential genes. In addition, the RT-qPCR were conducted to confirm the result of RNA-seq using the primers shown in Supplementary Table 1.

Statistical analysis

Microsoft Excel 2016 (Redmond, WA, USA) was used to process the data. SPSS version 28.0.2.0 (IBM Corp., Armonk, NY, USA) was used for the significant difference analysis, and GraphPad Prism (GraphPad Software Inc., Boston, MA, USA) and Adobe Photoshop (San Jose, CA, USA) were used to edit the images.

Results

Construction Infectious clones of TYLCV and infection in tomato and tobacco plants

The full-length sequence of TYLCV (2,781 bp) was amplified from the total DNA of tomato leaves, which showed symptoms obviously (Fig. 1A and B). The recombinant plasmid T-TYLCV, with the full-length genome sequence of TYLCV (GenBank: PP737594), was used as the template. The sequence was more than 98% homologous with the currently known TYLCV sequences in NCBI. It is the most homologous to infectious clones TYLCV-BJ (GenBank: MN432609.1), reached at 99.68%. To construct an infectious clone of TYLCV, two fragments covering a 1.4-fold virtual sequence amplified from T-TYLCV were assembled into circular plasmids (Fig. 1C), named pCambia1300-1.4TYLCV. The recombinant plasmid (pCambia1300-1.4TYLCV) was transformed into competent Agrobacterium cells and injected into virus-free tomato or tobacco seedlings. An empty vector (pCambia1300) served as a control group. After the tobacco and tomato seedlings had been infected for 10 days and 7 days, the apical leaves were collected, and RT-qPCR was used to detect the TYLCV replication level. The RT-qPCR results revealed a distinct and sharp peak, indicating that a TYLCV infectious clone was successfully constructed and systemic infection (Fig. 1D right). In contrast, the control group (empty vector) exhibited a disordered pattern of peaks, indicating no efficient process occurred (Fig. 1D left). The PCR result also demonstrated this result above (Fig. 1E).

Virus infection causes symptoms of viral disease in tomato and tobacco plants

More than 70% and 90% of tobacco and tomato plants (10-13 plants, three repeats) were systemically infected with pCambia1300-1.4TYLCV, as evidenced by PCR using the primer designed from conserved sequences V2 of TYLCV (Fig. 1E). The tomato plants exhibited severe chlorosis and dwarfing symptoms, with slight leaf curling 15 days post-infiltration (dpi) (Fig. 2A). Notably, visible necrotic spots were observed in the terminal leaves after virus infection, DAB, and trypan blue staining experiments were conducted to verify the leaves’ necrosis and the reactive oxygen species (ROS) content in the plants. Staining the apical leaves with DAB and trypan blue revealed that the hydrogen peroxide (H2O2) content was elevated, and more cells had died owing to inoculation with the virus in tomato terminal leaves (Fig. 2A). Concurrently, in experiments that involved tobacco leaves, chlorosis became apparent at 10 dpi (Fig. 2B), and the symptoms of viral infection in the tobacco leaves, including chlorosis and curling, were observed to be more rapid and pronounced compared to those in tomato leaves. The results from DAB and trypan blue staining of tobacco leaves were similar to those obtained from tomato leaves. This suggests that viral infection increased ROS levels and cellular necrosis in the tobacco leaves (Fig. 2B). Meanwhile, the leaves of tomato plants infected with the TYLCV clones remain chlorotic and slightly curled for a long time afterward. However, the upper leaves of tobacco curl severely and are accompanied by pronounced symptoms of dwarfism in the plants (Fig. 2C).

Analysis of the RNA-seq data

To clarify the impact of viral infection on the expression levels of endogenous genes in plants, RNA-seq was used to analyze the expression patterns of functional genes in plants infected with TYLCV compared to control plants. Total RNA was extracted from the leaves of tomato and tobacco for library construction. After filtering the original data, there were over 49 million high-quality sequences in the tomato group and more than 40 million reads in the tobacco group. The Q20 and Q30 values were both above 92%. A comparison of the clean reads with the tomato reference genes indicated that more than 92% of the total reads aligned with the reference genome were annotated in the reference data. In contrast, over 89% of the reads in the tobacco group were annotated in the reference data.
The RNA-seq data were analyzed using DESeq2. The log2 fold change value indicated the degree of difference between the samples. Differentially expressed genes (DEGs) between the control and TYLCV-infected plants were identified using the criterion |log2(FoldChange)| ≥ 1. The results revealed that 6,775 DEGs were up-regulated, while 6,480 were down-regulated in tobacco plants (Fig. 3A). In tomato plants, 900 DEGs were up-regulated and 1,601 were down-regulated (Fig. 3B). For a more precise analysis of genome sequencing, based on the threshold |log2(FoldChange)| ≥ 3, 1,951 DEGs were up-regulated and 753 were down-regulated in tobacco (Table 1), while there were 237 up-regulated and 294 down-regulated DEGs in tomatoes (Table 2). The genes up-regulated in tobacco plants included cytochrome P450s, MYB TFs, amino acid transporters, nucleoside diphosphate kinase, methylenetetrahydrofolate dehydrogenase, Ca2+-dependent phospholipid-binding protein, serine/threonine protein kinase, ribosomal protein, MADS-box TFs, superoxide dismutase, and kinases involved in autophagy, among others. Down-regulated genes in tobacco plants included cytochrome P450s, MYB and MADS-box TFs, apoptotic ATPase, inorganic phosphate transporter, calmodulin and related proteins, ribosomal protein, serine/threonine protein kinase, and ATP synthase, among others (Table 1). Additionally, the up-regulated genes in tomato plants included cytochrome P450s, MYB TFs, NADH-ubiquinone oxidoreductase, Ca2+-independent phospholipase, serine/threonine protein kinase, MADS-box TF, E3 ubiquitin ligase, heat shock protein, cytochrome C oxidase, and the RAV (Apetala2/ethylene response factor, AP2/ERF) gene family. Down-regulated genes in tomato included cytochrome P450s, a MYB TF, calcium transporting ATPase, CCAAT-binding factor, ribosomal protein, serine/threonine protein kinase, mitogen-activated protein kinase, superoxide dismutase, and heat shock protein (Table 2).

GO enrichment analysis of DEGs

The GO enrichment database compared tobacco plants inoculated with TYLCV to a control group. The up-regulated genes were categorized into three main categories: biological process, cellular component, and molecular function. The DEGs were significantly enriched in cellular processes, metabolic processes, response to stimuli, biological regulation, regulation of biological processes, developmental processes, multicellular organismal processes, cell parts, cells, organelle parts, membrane parts, catalytic activity, binding, transporter activity, signal transducer activity, and molecular transducer activity (Fig. 4A). The down-regulated genes were also categorized into three main areas: biological process, cellular component, and molecular function. The DEGs were significantly enriched in cellular processes, metabolic processes, response to stimuli, biological regulation, developmental processes, cells, organelles, membranes, catalytic activity, binding, transporter activity, structural molecule activity, and molecular transducer activity (Fig. 4B).
In TYLCV-infected tomato plants, the up-regulated genes were also annotated in biological processes, cellular components, and molecular functions. The DEGs were significantly enriched in cellular processes, metabolic processes, responses to stimuli, biological regulation, regulation of biological processes, developmental processes, multicellular organism processes, cell parts, cells, organelle parts, membrane parts, protein-containing complexes, catalytic activities, bindings, transporter activities, structural molecule activities, and antioxidant activities, among others (Fig. 5A). The down-regulated genes were significantly enriched in cellular processes, metabolic processes, biological regulation, responses to stimuli, developmental processes, cell parts, cells, organelle parts, protein-containing complexes, membranes, catalytic activities, bindings, transporter activities, TF activities, protein bindings, and molecular transducer activities (Fig. 5B).

KEGG enrichment analysis of the DEGs

The KEGG analysis was also utilized to examine the DEGs in tobacco and tomato plants. In tobacco plants, the up-regulated genes were mainly enriched in plant hormone signal transduction, ubiquitin-mediated proteolysis, tight junctions, the cell cycle, peroxisomes, and the FoxO signaling pathway. The plant hormone signal transduction pathway contained the most significant number of DEGs (Fig. 6A). Conversely, the down-regulated genes were primarily enriched in photosynthesis, plant-pathogen interaction, longevity regulating pathway-worm, phenylpropanoid biosynthesis, and the mitogen-activated protein kinase (MAPK) signaling pathway. The photosynthesis pathway featured the most significant number of DEGs (Fig. 6B).
In tomato plants, the up-regulated genes were mainly enriched in oxidative phosphorylation, plant hormone signal transduction, photosynthesis, the Wnt signaling pathway, retrograde endocannabinoid signaling, the MAPK signaling pathway, and metabolism-cytochrome P450. The oxidative phosphorylation pathway exhibited the highest number of DEGs (Fig. 7A). In contrast, the down-regulated genes were primarily enriched in plant hormone signal transduction, phenylpropanoid biosynthesis, pentose and glucuronate interconversions, peroxisome processes, and cutin, suberin, and wax biosynthesis and metabolism. The plant hormone signal transduction pathway also had the highest number of DEGs (Fig. 7B).

Confirmation of the expression of DEGs using RT-qPCR

To confirm the effect of TYLCV infection on gene expression patterns, the expression of some functional genes was selected to detect using RT-qPCR. The results are shown in Table 3.

The level of SlRAV2 gene expression affected the virus infection

To further investigate whether the virus response genes mentioned above impact virus infection and accumulation, we conducted transient gene silencing using TRV as the vector. It was shown that silencing the SlRAV2 gene, which belongs to the RAV (APETALA2/ETHYLENE RESPONSE FACTOR, AP2/ERF) gene family (Solyc10g086270.ITAG4.0), affected the accumulation of TYLCV in tomatoes. An Agrobacterium solution containing the TRV-SlRAV2 plasmid was infiltrated into tomato leaves for 3 days. We then inoculated the plants with the infectious clone of TYLCV and collected infected leaves at 3 dpi for virus detection by RT-qPCR. The results showed that silencing the RAV gene affected TYLCV accumulation in tomatoes but not in tobacco plants. When SlRAV2 was silenced, virus replication decreased in infiltrated leaves at 3 dpi (Fig. 8A), while in systemic leaves, virus accumulation increased at 10 dpi (Fig. 8B), and viral disease symptoms became severe in systemic leaves at 15 dpi (Fig. 8C).

Discussion

TYLCV poses a significant challenge to tomato production, warranting a thorough study of its infection process and the host’s defense mechanisms. In this experiment, an infectious clone of TYLCV was constructed, enabling a detailed analysis of its pathogenicity and its effects on tomato and tobacco plants. TYLCV infection altered the level of endogenous gene expression in plants, causing chlorosis, leaf curling, and even necrosis. RNA-seq can provide essential data on gene changes following virus infection, laying a foundation for subsequent studies on the molecular mechanisms of virus infection and plant resistance to viruses. Here, we report that TYLCV infection can cause changes in the expression of several genes associated with plant defense pathways, and we also identified that the RAV TF, which participates in the SA defense response pathway, can influence virus accumulation in tomato plants.
The construction of TYLCV infectious clones in this study, following currently established methodologies, was based on the protocols developed by Cañizares et al. (2015), Xue et al. (2015), Zhang et al. (2015), and Gong et al. (2022). Compared to previous studies that used degenerate primers from geminiviruses for amplification, this experiment utilized primers from the highly conserved V2 gene sequence of TYLCV to amplify the full-length genome. Previous studies have employed tomato and Arabidopsis as hosts to infect TYLCV, and the related symptoms caused by viral infection were also evident, with an infection rate exceeding 50% (Ouibrahim and Caranta, 2013). Due to the more extensive research requirements in future studies, tobacco (N. benthamiana) was used as the host instead of Arabidopsis. In this study, the TYLCV infectious clone could successfully and rapidly cause systemic infections on tobacco and tomato leaves, resulting in a 70% and 90% infection rate (10-12 plants, three repetitions) and displaying symptoms for about 15 days. The infection efficiency was higher than that of natural infection, which has been found to be around 50-60% (10-12 plants, three groups). The TYLCV infectious clone resulted in distinctly visible symptoms, including dwarfism and curling, and even significantly affected the growth of the tobacco plants at 10 dpi (Fig. 2B). Detecting CP or V2 genes from TYLCV in terminal tobacco leaves by using PCR and RT-qPCR also demonstrated successful virus infection and movement (Fig. 1D and E). However, in tomato seedlings, chlorotic symptoms were observed early in the infection stage, but the leaves curled less than those of plants infected naturally with TYLCV in the field (Figs. 1A and 2A). Despite this, after a certain period following infection, the CP or V2 genes were also detected in the apical leaves of the tomato plants, indicating that the infectious clone successfully and systemically infected the tomato plants (Fig. 1D and E). In terms of the milder diseases caused by artificially constructed infectious clones compared to those resulting from natural infections, we speculated that this may be due to the influence of the planting environment and virus transmission route, among other factors. Similar conditions have been noted in previous studies (Gong et al., 2022; Wu et al., 2006), which also require further optimization.
After TYLCV infection, discrete necrotic spots appeared on the tomato and tobacco leaves, indicating that infection with the virus affects the endogenous levels of ROS (Fig. 2A and B). In this study, we stained the leaves with DAB and trypan blue to evaluate the concentration of ROS and the extent of necrosis. The ROS content increased, causing the cells to become necrotic after virus infection. These results were consistent with previous studies in which plants regulated their ROS levels to enhance resistance to viruses (Hernández et al., 2016; Kozieł et al., 2024; Raza et al., 2021; Su et al., 2021; Zhang et al., 2010). Additionally, as demonstrated by Li et al. (2019), the application of SA enhances the virus resistance of tomato plants by modulating the expression of antioxidant genes to scavenge ROS. This study indicated that altering the activity of antioxidant enzymes related to virus resistance and inducing the expression levels of pathogenesis-related genes promote systemic acquired resistance and increase the resistance to TYLCV (Li et al., 2019; Yang et al., 2018). By combining the results of previous studies with this experiment, a positive correlation between virus content and ROS levels emerges to some extent, attributed to the changes in the expression levels of antioxidant enzyme genes caused by the virus infection.
The alteration of the physiological index is caused by the change in gene expression level. In this experiment, we confirmed that virus infection can directly modulate the expression of endogenous plant genes and explored whether viral infections elicit spontaneous disease resistance mechanisms in plants. The RNA-seq results revealed that upon virus infection, the expression of some genes, e.g., cytochrome P450s, MYB and MADS-box TFs, Ca2+-independent phospholipase, serine/threonine protein kinase, heat shock protein, mitogen-activated protein kinase, and E3 ubiquitin ligase were up-regulated in both tomato and tobacco plants. These genes are involved in plant disease resistance (Chakraborty et al., 2023; Geng et al., 2020; Hong et al., 2021; MacLean et al., 2014; Paul et al., 2021; Zhang et al., 2021). In addition, the CCAAT-binding factors also changed significantly in both the tomato and tobacco plants. These factors are partially linked to the SlGME1 promoter, which encodes GDP-Man-3′,5′-epimerase, a pivotal enzyme in the D-mannose/L-galactose pathway (Chen et al., 2020). We also detected the levels of MYB, cytochrome P450, E3 ubiquitin ligase, and MADS family genes using RT-qPCR, confirming their significant up-regulation. The results from Ding et al. (2019) indicated that TYLCV infection altered gene expression, including ubiquitination, MYB, MAPK, cytochrome P450 family, and heat shock protein 70, and highlighted the mechanisms related to plant disease and stress resistance. Notably, many genes within the MYB family were significantly up-regulated, and these findings are consistent with previous studies on gene expression levels triggered by TYLCV infection (Wang et al., 2015). They found that the MYB TF was involved in TYLCV infection through qRT-PCR expression analysis and virus-induced gene silencing (VIGS) validation. Furthermore, we hypothesize that a significant correlation exists between the protein encoded by the virus and the MYB TF, warranting further study. In this experiment, the response of tobacco after inoculation with the virus was more pronounced than that of tomato, suggesting that more genes were altered in tobacco. The RNA-seq results also revealed differences in the genetic changes resulting from virus infection in tobacco and tomato plants. Several genes from different pathways were exclusively altered in tobacco plants, including amino acid transporters, methylenetetrahydrofolate dehydrogenase, a kinase involved in autophagy, and a gene encoding a stress-responsive protein, among others. In 2019, Wu et al. conducted an RNA-seq of tobacco infected with TYLCV. Notably, they compared the transcriptome data of infiltrated and systemic leaves from tobacco separately, while this paper only analyzes the genes of systemic leaves. Our results are partially similar to those of Wu et al. (2019), including the altered GO, KEGG, and DEGs. These findings suggest that TYLCV infection may induce slightly different response patterns between tomato and tobacco plants. Additionally, the ROS-related superoxide dismutase gene in tobacco was up-regulated, contrasting with previous studies on TYLCV-infected whiteflies (Bemisia tabaci) (Ding et al., 2019), but down-regulated in tomato plants, aligning with previous findings.
The VIGS validation was conducted, silencing several genes whose expression levels changed following TYLCV infection in tomato plants. The results showed that TYLCV accumulation did not significantly change. Only one gene from the RAV family was found to affect the virus’ accumulation level after being silenced in tomato plants. This gene belongs to the AP2/ERF TFs in tomato plants (Licausi et al., 2013; Okushima et al., 2005). The RAV TF was up-regulated during viral infection in both tomato and tobacco plants; however, overexpression or silencing of RAV affected virus infection only in tomato plants. Evidence shows that members of the AP2/ERF superfamily play complex roles in plants under biotic stress; they participate in various hormonal signaling pathways and induce PR genes in response to pathogen attacks (Endres et al., 2010; Feng et al., 2020; Zhang et al., 2022). This subfamily can activate PR genes by binding to the GCC box of the promoter and triggering downstream antiviral defense responses (Park et al., 2001; Pre et al., 2008). In this experiment, we found that silencing RAV can reduce the level of virus accumulation (Fig. 8A), while the symptoms of tomato virus disease appeared to be more pronounced. Therefore, the results indicate that this gene is associated with the tomato disease resistance pathway. We speculate that silencing RAV leads to a decrease in the accumulation level of the virus in the infiltrating leaves (Fig. 8A and B) through unclear mechanisms for a short period of time, without a burst of ROS, which instead may promote rapid viral replication and spread to the terminal leaves; consequently, the symptoms of viral disease in the terminal leaves become more severe (Fig. 8C). This prediction is based on previous studies and the results of this experiment. Huang et al. (2016b) reported the relationship between RAV and TYLCV infection, indicating that RAV can interact with MAPK to protect against virus infection. The expression level of this gene changed in response to external stimuli and defense signals after virus infection. This gene may also indirectly lead to a hypersensitive response, resulting in lower ROS content and preventing the plant from initiating a defense response, which allows the virus to spread more aggressively. This hypothesis of virus-plants interaction molecular mechanism was also mentioned in Sun and Folimonova (2019) and Xie et al. (2024). However, there has been no direct confirmation of this mechanism. Combined with RNA-seq and TRV silencing results, further analysis is needed to explore the in-depth relationship between plant-virus interactions. We hypothesized that SlRAV2 relates to the initial defense against the virus or interacts with TYLCV-encoded pathogenic proteins.
Additionally, the results in Tables 1 and 2 indicated that certain genes associated with plant disease resistance, such as cytochrome P450s, ATP synthase gamma chain, and superoxide dismutase, were down-regulated following TYLCV infection in tomatoes. This finding partly aligns with previous studies (Chen et al., 2013; Ding et al., 2019; Jammes et al., 2024), which may be attributed to variations in sampling time or leaf position (infiltrating leaves or systemic leaves) (Wu et al., 2019). It is hypothesized that during the virus infection process, the negative impacts of the virus on plants and the plant’s resistance to the virus reach an antagonistic balance. Changes in external factors might lead to various viral diseases by influencing the ratio of resistance genes. This mechanism could explain why tomato plants cultivated in fields exhibit more severe symptoms of TYLCV than those grown in the laboratory.
To safeguard agricultural produce from the devastating effects of viral infections, building upon the findings of this study, it must delve deeper into genes associated with virus infection in the future.

Notes

Conflicts of Interest

The authors declare no conflict of interest.

Acknowledgments

This research was funded by National Natural Science Foundation of China (32302527), Natural Science Foundation of Hebei Province (C2023106001).

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

Fig. 1
The development of an infectious clone for the tomato yellow leaf curl virus (TYLCV) and its application in tomato and tobacco plants. (A) Tomato plants showing symptoms of TYLCV disease. (B) The identification of the amplified full-length sequence of the virus. (C) Protocol of TYLCV infectious clone construction. (D) Expression of CP gene of TYLCV in tobacco (upper line) or tomato (bottom line) plants. real-time fluorescence quantitative PCR result of the control (empty vector) and treatment (infected by TYLCV infectious clone) was shown on the left and right panels, respectively. (E) Detection of the V2 gene of TYLCV in tobacco or tomato apical leaves.
ppj-oa-12-2024-0191f1.jpg
Fig. 2
The pathogenicity of tomato yellow leaf curl virus (TYLCV) in tomato and tobacco plants. (A) Tomato seedlings infected with TYLCV were photographed at 15 days post-infiltration (dpi), and the apical leaves were stained with 3,3′-diaminobenzidine (DAB) or trypan blue. (B) Nicotiana benthamiana seedlings infected with TYLCV were photographed at 10 dpi, and the apical leaves were stained with DAB or trypan blue. (C) The tobacco plants exhibit serious leaf rolling and dwarfing symptoms at 20 dpi.
ppj-oa-12-2024-0191f2.jpg
Fig. 3
Differentially expressed genes in systematical leaves of tomato yellow leaf curl virus-infected tobacco (A) and tomato (B) plants. RNA was extracted from the leaves of plants at 7 dpi. Red dots, up-regulated genes; green dots, down-regulated genes; black dots, genes that did not change significantly. x-axis, fold-change; y-axis, −log10 (qValue).
ppj-oa-12-2024-0191f3.jpg
Fig. 4
Gene ontology (GO) analysis of differentially expressed genes (DEGs) in tomato yellow leaf curl virus-infected Nicotiana benthamiana plants. GO enrichment analysis results of up-regulated (A) and down-regulated (B) DEGs were noted.
ppj-oa-12-2024-0191f4.jpg
Fig. 5
Gene ontology (GO) analysis of differentially expressed genes (DEGs) in tomato yellow leaf curl virus-infected tomato plants. GO enrichment analysis results of up-regulated (A) and down-regulated (B) DEGs were noted.
ppj-oa-12-2024-0191f5.jpg
Fig. 6
Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of differentially expressed genes (DEGs) in tomato yellow leaf curl virus-infected Nicotiana benthamiana plants. KEGG enrichment analysis results of up-regulated (A) and down-regulated (B) DEGs were noted.
ppj-oa-12-2024-0191f6.jpg
Fig. 7
Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of differentially expressed genes (DEGs) in tomato yellow leaf curl virus-infected tomato plants. KEGG enrichment analysis results of up-regulated (A) and down-regulated (B) DEGs were noted.
ppj-oa-12-2024-0191f7.jpg
Fig. 8
The silencing of SlRAV2 resulted in elevated viral accumulation. (A) SlRAV2 silencing and tomato yellow leaf curl virus (TYLCV) accumulation results in infiltrated leaves were detected by real-time fluorescence quantitative PCR. (B) The TYLCV replication level was up-regulated under SlRAV2 silencing in terminal leaves. (C) The symptoms of tomato virus disease under SlRAV2 silencing.
ppj-oa-12-2024-0191f8.jpg
Table 1
Differentially expressed genes in tobacco plants after TYLCV infection
No. of genes
Up-regulated genes annotation
 Cytochrome P450 52
 MYB transcription factor 42
 Amino acid transporters 22
 Nucleoside diphosphate kinase 2
 Methylenetetrahydrofolate dehydrogenase 2
 Ca2+-dependent phospholipid-binding protein 15
 Serine/threonine protein kinase 134
 Ribosomal protein 36
 Stress-responsive protein 1
 Mitogen-activated protein kinase 5
 MADS-box transcription factor 16
 Heat shock protein 9
 Superoxide dismutase 2
 Kinase involved in autophagy 3
 CCAAT-binding factor 7
 E3 ubiquitin protein ligase 1
 RAV transcription factor 1
 Other 1,601
Down-regulated genes annotation
 Cytochrome P450 37
 MYB transcription factor 16
 MADS-box transcription factor 4
 Apoptotic ATPase 26
 Inorganic phosphate transporter 2
 Calmodulin and related proteins 17
 Ribosomal protein 29
 Serine/threonine protein kinase 74
 ATP synthase 6
 Transcription factor GT-2 and related proteins 5
 MEKK 5
 E3 ubiquitin protein ligase 1
 Heat shock protein 11
 Other 520

TYLCV, tomato yellow leaf curl virus.

Table 2
Differentially expressed genes in tomato plants after TYLCV infection
No. of genes
Up-regulated genes annotation
 Cytochrome P450 17
 MYB transcription factor 3
 NADH-ubiquinone oxidoreductase 7
 Ca2+-independent phospholipase 2
 Serine/threonine protein kinase 23
 MADS-box transcription factor 5
 E3 ubiquitin protein ligase 1
 RAV transcription factor 1
 Heat shock protein 1
 Cytochrome C oxidase 4
 Other 173
Down-regulated genes annotation
 Cytochrome P450 22
 MYB transcription factor 13
 Calcium transporting ATPase 3
 CCAAT-binding factor 2
 Ribosomal protein 6
 Superoxide dismutase 1
 Serine/threonine protein kinase 29
 Mitogen-activated protein kinase 1
 Heat shock protein 3
 Other 214

TYLCV, tomato yellow leaf curl virus.

Table 3
The DEGs for RT-qPCR detection
Gene id Gene description Relative expression (fold of change)
Solyc03g111997.1.ITAG4.0 Cytochrome P450 CYP2 subfamily [Solanum lycopersicum] 3.73 ± 0.22
Solyc10g086270.ITAG4.0 Transcription factor, Myb superfamily [Solanum lycopersicum] 4.11 ± 0.43
Solyc01g106170.ITAG4.0 MADS box transcription factor [Solanum lycopersicum] 3.35 ± 1.12
Soly05g009790.1.ITAG4.0 AP2/ERF transcription factor [Solanum lycopersicum] 1.1 ± 0.15
Solyc10g150113.ITAG4.0 Ubiquitin mediated proteolysis [Solanum lycopersicum] 1.33 ± 0.23
Solyc01g009320.ITAG4.0 Chaperone-dependent E3 ubiquitin protein ligase [Solanum lycopersicum] 2.11 ± 1.10
Niben261Chr14g1373007 Cytochrome P450 CYP2 subfamily [Nicotiana benthamiana] 5.33 ± 2.12
Niben261Chr13g1141009 Transcription factor, Myb superfamily [Nicotiana benthamiana] 6.12 ± 2.32
Niben261Chr07g1078009 MADS box transcription factor [Nicotiana benthamiana] 4.12 ± 1.11
Niben261Chr04g0997005 Ubiquitin-protein ligase [Nicotiana benthamiana] 4.63 ± 1.57
Niben261Chr12g0253030 E3 ubiquitin protein ligase [Nicotiana benthamiana] 4.93 ± 2.11
Niben261Chr16g0448006 Ubiquitin-protein ligase [Nicotiana benthamiana] 1.20 ± 0.52
Niben261Scf13067g0000004 Manganese superoxide dismutase [Nicotiana benthamiana] 3.15 ± 0.24

DEG, differentially expressed gene; RT-qPCR, real-time fluorescence quantitative PCR.

References

Ali, S., Ahmad Nasir, I., Rafiq, M., Javed Butt, S., Ihsan, F., Qayyum Rao, A. and Husnain, T. 2017. Sugarcane mosaic virus-based gene silencing in Nicotiana benthamiana. Iran. J. Biotechnol. 15:260-267.
crossref pmid pmc pdf
Bar-Ziv, A., Levy, Y., Citovsky, V. and Gafni, Y. 2015. The tomato yellow leaf curl virus (TYLCV) V2 protein inhibits enzymatic activity of the host papain-like cysteine protease CYP1. Biochem. Biophys. Res. Commun. 460:525-529.
crossref pmid pmc
Cañizares, M. C., Rosas-Díaz, T., Rodríguez-Negrete, E., Hogenhout, S. A., Bedford, I. D., Bejarano, E. R., Navas-Castillo, J. and Moriones, E. 2015. Arabidopsis thaliana, an experimental host for tomato yellow leaf curl disease-associated begomoviruses by agroinoculation and whitefly transmission. Plant Pathol. 64:265-271.
crossref
Cao, X., Huang, M., Wang, S., Li, T. and Huang, Y. 2024. Tomato yellow leaf curl virus: characteristics, influence, and regulation mechanism. Plant Physiol. Biochem. 213:108812.
crossref pmid
Chakraborty, P., Biswas, A., Dey, S., Bhattacharjee, T. and Chakrabarty, S. 2023. Cytochrome P450 gene families: role in plant secondary metabolites production and plant defense. J. Xenobiot. 13:402-423.
crossref pmid pmc
Chen, T., Lv, Y., Zhao, T., Li, N., Yang, Y., Yu, W., He, X., Liu, T. and Zhang, B. 2013. Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum) cultivar in response to infection by tomato yellow leaf curl virus. PLoS ONE 8:e80816.
crossref pmid pmc
Chen, W., Hu, T., Ye, J., Wang, B., Liu, G., Wang, Y., Yuan, L., Li, J., Li, F., Ye, Z. and Zhang, Y. 2020. A CCAAT-binding factor, SlNFYA10, negatively regulates ascorbate accumulation by modulating the D-mannose/L-galactose pathway in tomato. Hortic. Res. 7:200.
crossref pmid pmc pdf
Chen, Y., Guo, S., Jiang, L., Yan, F., Hao, K., Wang, Z., An, M., Xia, Z., Li, F., Zhou, X. and Wu, Y. 2024. Molecular characterization and pathogenicity of a novel monopartite geminivirus infecting tobacco in China. Virology 594:110061.
crossref pmid
Czosnek, H., Eybishtz, A., Sade, D., Gorovits, R., Sobol, I., Bejarano, E., Rosas-Díaz, T. and Lozano-Durán, R. 2013. Discovering host genes involved in the infection by the tomato yellow leaf curl virus complex and in the establishment of resistance to the virus using tobacco rattle virus-based post transcriptional gene silencing. Viruses 5:998-1022.
crossref pmid pmc
Ding, T.-B., Li, J., Chen, E.-H., Niu, J.-Z. and Chu, D. 2019. Transcriptome profiling of the whitefly Bemisia tabaci MED in response to single infection of tomato yellow leaf curl virus, tomato chlorosis virus, and their coinfection. Front. Physiol. 10:302.
crossref pmid pmc
Dong, X., van Wezel, R., Stanley, J. and Hong, Y. 2003. Functional characterization of the nuclear localization signal for a suppressor of post-transcriptional gene silencing. J. Virol. 77:7026-7033.
crossref pmid pmc pdf
Endres, M. W., Gregory, B. D., Gao, Z., Foreman, A. W., Mlotshwa, S., Ge, X., Pruss, G. J., Ecker, J. R., Bowman, L. H. and Vance, V. 2010. Two plant viral suppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing. PLoS Pathog. 6:e1000729.
crossref pmid pmc
Eybishtz, A., Peretz, Y., Sade, D., Akad, F. and Czosnek, H. 2009. Silencing of a single gene in tomato plants resistant to tomato yellow leaf curl virus renders them susceptible to the virus. Plant Mol. Biol. 71:157-171.
crossref pmid pdf
Feng, K., Hou, X.-L., Xing, G.-M., Liu, J.-X., Duan, A.-Q., Xu, Z.-S., Li, M.-Y., Zhuang, J. and Xiong, A.-S. 2020. Advances in AP2/ERF super-family transcription factors in plant. Crit. Rev. Biotechnol. 40:750-776.
crossref pmid
Garnelo Gómez, B., Zhang, D., Rosas-Díaz, T., Wei, Y., Macho, A. P. and Lozano-Durán, R. 2019. The C4 protein from tomato yellow leaf curl virus can broadly interact with plant receptor-like kinases. Viruses 11:1009.
crossref pmid pmc
Geng, P., Zhang, S., Liu, J., Zhao, C., Wu, J., Cao, Y., Fu, C., Han, X., He, H. and Zhao, Q. 2020. MYB20, MYB42, MYB43, and MYB85 regulate phenylalanine and lignin biosynthesis during secondary cell wall formation. Plant Physiol. 182:1272-1283.
crossref pmid pmc
Glick, E., Zrachya, A., Levy, Y., Mett, A., Gidoni, D., Belausov, E., Citovsky, V. and Gafni, Y. 2008. Interaction with host SGS3 is required for suppression of RNA silencing by tomato yellow leaf curl virus V2 protein. Proc. Natl. Acad. Sci. U. S. A. 105:157-161.
crossref pmid pmc
Gong, P., Zhao, S., Zhou, X. P. and Li, F. F. 2022. Construction of Infectious clone of tomato yellow leaf curl virus Beijing isolate and its pathogenicity. J. Plant Prot. 49:871-878 (in Chinese).
Hernández, J. A., Gullner, G., Clemente-Moreno, M. J., Künstler, A., Juhász, C., Díaz-Vivancos, P. and Király, L. 2016. Oxidative stress and antioxidative responses in plant-virus interactions. Physiol. Mol. Plant Pathol. 94:134-148.
crossref
Hong, L., Niu, F., Lin, Y., Wang, S., Chen, L. and Jiang, L. 2021. MYB117 is a negative regulator of flowering time in Arabidopsis. Plant Signal. Behav. 16:1901448.
crossref pmid pmc
Huang, Y., Li, M.-Y., Wu, P., Xu, Z.-S., Que, F., Wang, F. and Xiong, A.-S. 2016a. Members of WRKY group III transcription factors are important in TYLCV defense signaling pathway in tomato (Solanum lycopersicum). BMC Genomics 17:788.
crossref pmid pmc pdf
Huang, Y., Li, T., Xu, Z.-S., Wang, F. and Xiong, A.-S. 2017. Six NAC transcription factors involved in response to TYLCV infection in resistant and susceptible tomato cultivars. Plant Physol. Biochem. 120:61-74.
crossref
Huang, Y., Zhang, B.-L., Sun, S., Xing, G.-M., Wang, F., Li, M.-Y., Tian, Y.-S. and Xiong, A.-S. 2016b. AP2/ERF transcription factors involved in response to tomato yellow leaf curly virus in tomato. Plant Genome 9:plantgenome2015.09.0082.
crossref pdf
Jammes, M., Golyaev, V., Fuentes, A., Laboureau, N., Urbino, C., Plissonneau, C., Peterschmitt, M. and Pooggin, M. M. 2024. Transcriptome and small RNAome profiling uncovers how a recombinant begomovirus evades RDRγ-mediated silencing of viral genes and outcompetes its parental virus in mixed infection. PLoS Pathog. 20:e1011941.
crossref pmid pmc
Kozieł, E., Otulak-Kozieł, K. and Rusin, P. 2024. Glutathione-the “master” antioxidant in the regulation of resistant and susceptible host-plant virus-interaction. Front. Plant Sci. 15:1373801.
pmid pmc
Li, T., Huang, Y., Xu, Z.-S., Wang, F. and Xiong, A.-S. 2019. Salicylic acid-induced differential resistance to the tomato yellow leaf curl virus among resistant and susceptible tomato cultivars. BMC Plant Biol. 19:173.
crossref pmid pmc pdf
Licausi, F., Ohme-Takagi, M. and Perata, P. 2013. APETALA2/ethylene responsive factor (AP2/ERF) transcription factors: mediators of stress responses and developmental programs. New Phytol. 199:639-649.
pmid
Liu, B., Preisser, E. L., Jiao, X., Xu, W. and Zhang, Y. 2021. Lethal and sublethal effects of flupyradifurone on Bemisia tabaci MED (Hemiptera: Aleyrodidae) feeding behavior and TYLCV transmission in tomato. J. Econ. Entomol. 114:1072-1080.
crossref pmid pdf
MacLean, A. M., Orlovskis, Z., Kowitwanich, K., Zdziarska, A. M., Angenent, G. C., Immink, R. G. H. and Hogenhout, S. A. 2014. Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner. PLoS Biol. 12:e1001835.
crossref pmid pmc
Moriones, E. and Navas-Castillo, J. 2000. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res. 71:123-134.
crossref pmid
Okushima, Y., Mitina, I., Quach, H. L. and Theologis, A. 2005. AUXIN RESPONSE FACTOR 2 (ARF2): a pleiotropic developmental regulator. Plant J. 43:29-46.
crossref pmid
Ouibrahim, L. and Caranta, C. 2013. Exploitation of natural genetic diversity to study plant-virus interactions: what can we learn from Arabidopsis thaliana? Mol. Plant Pathol. 14:844-854.
pmid pmc
Park, J. M., Park, C. J., Lee, S. B., Ham, B. K., Shin, R. and Paek, K. H. 2001. Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell 13:1035-1046.
crossref pmid pmc
Paul, A., Srivastava, A. P., Subrahmanya, S., Shen, G. and Mishra, N. 2021. In-silico genome wide analysis of mitogen activated protein kinase kinase kinase gene family in C. sinensis. PLoS ONE 16:e0258657.
crossref pmid pmc
Péréfarres, F., Thierry, M., Becker, N., Lefeuvre, P., Reynaud, B., Delatte, H. and Lett, J.-M. 2012. Biological invasions of geminiviruses: case study of TYLCV and Bemisia tabaci in Reunion Island. Viruses 4:3665-3688.
crossref pmid pmc
Prasad, A., Sharma, N., Hari-Gowthem, G., Muthamilarasan, M. and Prasad, M. 2020. Tomato yellow leaf curl virus: impact, challenges, and management. Trends Plant Sci. 25:897-911.
crossref pmid
Pre, M., Atallah, M., Champion, A., De Vos, M., Pieterse, C. M. J. and Memelink, J. 2008. The AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and ethylene signals in plant defense. Plant Physiol. 147:1347-1357.
crossref pmid pmc pdf
Raza, A., Su, W., Gao, A., Mehmood, S. S., Hussain, M. A., Nie, W., Lv, Y., Zou, X. and Zhang, X. 2021. Catalase (CAT) gene family in rapeseed (Brassica napus L.): genome-wide analysis, identification, and expression pattern in response to multiple hormones and abiotic stress conditions. Int. J. Mol. Sci. 22:4281.
crossref pmid pmc
Romero-Rodríguez, B., Petek, M., Jiao, C., Križnik, M., Zagorščak, M., Fei, Z., Bejarano, E. R., Gruden, K. and Castillo, A. G. 2023. Transcriptional and epigenetic changes during tomato yellow leaf curl virus infection in tomato. BMC Plant Biol. 23:651.
pmid pmc
Rosas-Diaz, T., Cana-Quijada, P., Wu, M., Hui, D., Fernandez-Barbero, G., Macho, A. P., Solano, R., Castillo, A. G., Wang, X.-W., Lozano-Duran, R. and Bejarano, E. R. 2023. The transcriptional regulator JAZ8 interacts with the C2 protein from geminiviruses and limits the geminiviral infection in Arabidopsis. J. Integr. Plant Biol. 65:1826-1840.
crossref pmid pdf
Su, W., Raza, A., Gao, A., Jia, Z., Zhang, Y., Hussain, M. A., Mehmood, S. S., Cheng, Y., Lv, Y. and Zou, X. 2021. Genome-wide analysis and expression profile of superoxide dismutase (SOD) gene family in rapeseed (Brassica napus L.) under different hormones and abiotic stress conditions. Antioxidants 10:1182.
crossref pmid pmc
Sun, Y.-D. and Folimonova, S. Y. 2019. The p33 protein of Citrus tristeza virus affects viral pathogenicity by modulating a host immune response. New Phytol. 221:2039-2053.
crossref pmid pdf
Wang, B., Yang, X., Wang, Y., Xie, Y. and Zhou, X. 2018. Tomato yellow leaf curl virus V2 interacts with host histone deacetylase 6 to suppress methylation-mediated transcriptional gene silencing in plants. J. Virol. 92:e00036-18.
crossref pmid pmc pdf
Wang, J., Hu, Z., Zhao, T., Yang, Y., Chen, T., Yang, M., Yu, W. and Zhang, B. 2015. Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum). BMC Genomics 16:39.
crossref pmid pmc pdf
Wang, S., Zhang, Z., Tang, R., He, F., Huang, Y., Nie, Z. and Lei, C. 2023. Responsive MXene nanovehicles deliver CRISPR/Cas12a for boolean logic-controlled gene editing. Sci. Chin. Chem. 65:2318-2326.
crossref pdf
Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F., Gronenborn, B. and Jupin, I. 1997. Genetic analysis of the monopartite tomato yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral pathogenesis. Virology 228:132-140.
crossref pmid
Wei, Y., Gao, L., Zhang, Z., Li, K., Zhang, Z., Zhang, D., Chen, J., Peng, J., Gao, Y., Du, J., Yan, S., Shi, X. and Liu, Y. 2024. D-Limonene affects the feeding behavior and the acquisition and transmission of tomato yellow leaf curl virus by Bemisia tabaci. Viruses 16:300.
crossref pmid pmc
Wu, M., Ding, X., Fu, X. and Lozano-Duran, R. 2019. Transcriptional reprogramming caused by the geminivirus tomato yellow leaf curl virus in local or systemic infections in Nicotiana benthamiana. BMC Genomics 20:542.
crossref pmid pmc pdf
Xie, Y.-S., Zeng, Q., Huang, W.-T., Wang, J.-Y., Li, H.-W., Yu, S.-Z., Liu, C., Zhang, X.-Q., Feng, C.-L., Zhang, W.-H., Li, T.-Z. and Cheng, Y.-Q. 2024. A novel RAV transcription factor from pear interacts with viral RNA-silencing suppressors to inhibit viral infection. Plant J. 120:1079-1093.
pmid
Xue, D. Q., Liu, G., Jiang, J. B., Xu, X. X. and Li, J. F. 2015. TYLCV shandong isolate strain differentiation and infect the cloned build. J. Northeast Agric. Univ. 46:26-33.
Wu, J. B., Dai, F. M. and Zhou, X. P. 2006. First report of tomato yellow leaf curl virus in China. Plant Dis. 10:1359.
crossref
Yang, M., Li, Z., Zhang, K., Zhang, X., Zhang, Y., Wang, X., Han, C., Yu, J., Xu, K. and Li, D. 2018. Barley stripe mosaic virus γb interacts with glycolate oxidase and inhibits peroxisomal ROS production to facilitate virus infection. Mol. Plant 11:338-341.
crossref pmid
Zhang, C., He, P., Yu, Z., Du, D. and Wei, P. 2010. Effect of exogenous Ca2+, ALA, SA and Spd on seed germination and physiological characteristics of Perilla frutescens seedlings under NaCl stress. China J. Chin. Mater. Med. 35:3260-3265.
Zhang, C., Wang, X., Li, H., Wang, J., Zeng, Q., Huang, W., Huang, H., Xie, Y., Yu, S., Kan, Q., Wang, Q. and Cheng, Y. 2022. GLRaV-2 protein p24 suppresses host defenses by interaction with a RAV transcription factor from grapevine. Plant Physiol. 189:1848-1865.
crossref pmid pmc pdf
Zhang, X., Wang, X., Xu, K., Jiang, Z., Dong, K., Xie, X., Zhang, H., Yue, N., Zhang, Y., Wang, X.-B., Han, C., Yu, J. and Li, D. 2021. The serine/threonine/tyrosine kinase STY46 defends against hordeivirus infection by phosphorylating γb protein. Plant Physiol. 186:715-730.
crossref pmid pmc pdf
Zhang, Y. X., Yuan, L., Zheng, Y. Y. and Xiang, B. C. 2015. Tomato yellow leaf virus infection sex cloning piece of building. J. Shihezi Univ. (Nat. Sci. Ed.) 6:672-676 (in Chinese).
Zhao, S., Gong, P., Ren, Y., Liu, H., Li, H., Li, F. and Zhou, X. 2022. The novel C5 protein from tomato yellow leaf curl virus is a virulence factor and suppressor of gene silencing. Stress Biol. 2:19.
crossref pmid pmc pdf
Zhao, W., Wu, S., Barton, E., Fan, Y., Ji, Y., Wang, X. and Zhou, Y. 2020. Tomato yellow leaf curl virus V2 protein plays a critical role in the nuclear export of V1 protein and viral systemic infection. Front. Microbiol. 11:1243.
crossref pmid pmc
Zhao, W., Zhou, Y., Zhou, X., Wang, X. and Ji, Y. 2021. Host GRXC6 restricts tomato yellow leaf curl virus infection by inhibiting the nuclear export of the V2 protein. PLoS Pathog. 17:e1009844.
crossref pmid pmc
Zhong, M.-C., Jiang, X.-D., Yang, G.-Q., Cui, W.-H., Suo, Z.-Q., Wang, W.-J., Sun, Y.-B., Wang, D., Cheng, X.-C., Li, X.-M., Dong, X., Tang, K.-X., Li, D.-Z. and Hu, J.-Y. 2021. Rose without prickle: genomic insights linked to moisture adaptation. Nat. Sci. Rev. 8:nwab092.
crossref pmid pmc pdf
Zhou, X. P., Cui, X. F. and Tao, X. R. 2003. Geminiviruses: an emerging threat for crop production. Acta Phytopathol. Sin. 33:487-492.
TOOLS
METRICS Graph View
  • 4 Web of Science
  • 5 Crossref
  •  0 Scopus
  • 6,113 View
  • 182 Download
ORCID iDs

Chenwei Zhang
https://orcid.org/0000-0003-1765-0328

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next