A Precise TaqMan-Based Real-Time qPCR Assay for Detecting and Quantifying Blackberry Chlorotic Ringspot Virus, Blueberry Shock Virus, and Plum Pox Virus in Fruit Tree Seedlings

Article information

Plant Pathol J. 2025;41(5):619-627
Publication date (electronic) : 2025 October 1
doi : https://doi.org/10.5423/PPJ.OA.05.2025.0065
1Department of Agricultural Biotechnology, Seoul National University, Seoul 08826, Korea
2Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea
3Plant Genomics and Breeding Institute, Seoul National University, Seoul 08826, Korea
4SNU Plant Health Center, Seoul National University, Seoul 08826, Korea
*Corresponding author. Phone) +82-2-880-4677, FAX) +82-2-873-2317, E-mail) kookkim@snu.ac.kr
†These authors contributed equally to this work.Handling Editor : Ju-Yeon Yoon
Received 2025 May 14; Revised 2025 June 30; Accepted 2025 August 7.

Abstract

We developed a rapid and efficient TaqMan-based real-time reverse transcription quantitative PCR (RT-qPCR) assay for the detection and quantification of viruses infecting fruit trees, including blackberry chlorotic ringspot virus (BCRV), blueberry shock virus (BlShV), and plum pox virus (PPV). The detection limits for each virus were 40 copies (BCRV), 500 copies (BlShV), and 40 copies (PPV), respectively. Two primer–probe sets were selected for each virus, with amplification efficiencies ranging from 90–110%. High specificity was confirmed against other viruses or viroids sharing the same host plants. Multiplex detection of BCRV, BlShV, and PPV was achieved by using FAM and Cy5 fluorescent dyes. All sets maintained high efficiency and sensitivity with varying amounts of RNA extracted from the woody branches of the host plant. This assay will be useful for rapid and accurate diagnosis of plant virus diseases, especially in quarantine stations where leaf tissue is often unavailable upon import.

Plant pathogens represent a significant threat to global food production, causing an estimated 15% loss in crop yields (Barford, 2013). Traditional methods to control pathogens include breeding resistant cultivars, applying chemical treatments, and removing infected plants (Altieri, 2018). However, these practices can be economically and environmentally burdensome, and pathogens are challenging to eradicate once established. Therefore, preventive measures are strongly preferred and often required.

In Korea, the number of imported nursery stocks has steadily increased since 2012, with approximately 80 million seedlings imported annually as of 2022. Following quarantine inspections, 10–15% of these imported plants are destroyed or disinfected (Animal and Plant Quarantine Agency, 2022). Despite these efforts, blackberry chlorotic ringspot virus (BCRV) and plum pox virus (PPV) breached the Korean quarantine system in 2017, primarily due to the lack of precise diagnostic protocols at that time (Oh et al., 2017; Seo et al., 2017). Because viruses are submicroscopic and many imported seedlings arrive without leaves, symptom-based detection methods are unreliable.

Reliable detection methods are therefore essential for effective quarantine inspection. Traditional detection techniques such as visual inspection, biological indexing, and enzyme-linked immunosorbent assay are still widely used but have notable limitations in sensitivity, efficiency, and consistency, particularly when virus concentrations are low or unevenly distributed within host tissues (Beaver-Kanuya and Harper, 2020; Bruisson et al., 2017). Molecular diagnostic methods, especially real-time reverse transcription quantitative PCR (RT-qPCR), have become the gold standard for plant virus detection due to their high sensitivity, specificity, and rapid turnaround (Mackay et al., 2002; Menzel et al., 2002).

TaqMan-based assays are particularly advantageous in quarantine settings because of their closed-tube format, quantitative results, and multiplexing capability, which helps reduce false negatives through internal controls (Jung et al., 2024; López et al., 2003). This multiplex format is particularly beneficial for detecting latent or asymptomatic infections, such as those caused by apple chlorotic leaf spot virus (ACLSV) or BCRV (Beaver-Kanuya and Harper, 2020; Poudel et al., 2014). Although isothermal amplification methods such as recombinase polymerase amplification provide rapid field-based detection (Jiao et al., 2019), RT-qPCR remains the most robust, scalable, and validated approach for routine quarantine testing of nursery stock and other regulated plant materials.

In this study, we developed and validated a TaqMan-based multiplex RT-qPCR assay for the simultaneous detection of three important fruit-tree viruses—blueberry shock virus (BlShV), BCRV, plum pox virus (PPV) for which reliable diagnostic tools were previously lacking in the Korean quarantine system. BlShV, a member of the genus Ilarvirus, was first reported in 1991 (MacDonald et al., 1991) and can cause significant yield losses depending on conditions (Bristow et al., 2002). Infected plants often recover symptomatically but can continue to serve as inoculum reservoirs (Bristow et al., 2002). BCRV, another member of the genus Ilarvirus, was initially identified in blackberries in the United Kingdom and roses in the United States in 2006 (Jones et al., 2006; Poudel, 2011) and was subsequently detected in Korea in 2017 (Seo et al., 2017). It typically causes mild symptoms alone but may result in severe disease symptoms when co-infected with other viruses (Poudel, 2011). PPV is among the most economically significant stone-fruit pathogens globally, causing annual economic losses of approximately $600 million (Fuchs et al., 2008). PPV is classified within the genus Potyvirus and comprises at least nine genetically diverse strains (Fotiou et al., 2019), complicating detection efforts.

Considering these challenges, we evaluated multiple primer and probe sets for each virus based on their amplification efficiency, analytical sensitivity, and specificity. To ensure practical applicability in quarantine inspections, we conducted comprehensive testing, including multiplexing capability and detection in woody tissues, which are frequently the only material available during import inspections.

Materials and Methods

Virus sample collection

To assess the specificity of the assay, we obtained non-target virus and viroid isolates, including tobacco ringspot virus (TRSV; PV-0180), blackberry yellow vein-associated virus (BYVaV; KNU-V1012-2), BCRV (CV201130-8), blueberry latent mosaic virus (BLMV; GC-15), hop stunt viroid (HSVd), ACLSV, and peach necrotic ringspot virus (PNSRV; CS). These isolates were obtained from the National Institute of Agricultural Sciences (NIAS) and the National Institute of Horticultural and Herbal Science (NIHHS), both of which are part of the Rural Development Administration in the Republic of Korea. PPV (VPH D strain) was provided by Dr. A. Wang (Agriculture and Agri-Food Canada). Leaves, soft tissues (e.g., young stems), and woody branches from Nicotiana benthamiana, Rubus coreanus, Vaccinium spp., and Prunus persica seedlings (NIHHS) served as negative controls. All isolates and controls used in this study are listed in Table 1.

List of plant and virus materials and their Cq value from the detection set

Construction of positive control standards

We synthesized the BlShV coat protein (CP) region and amplified the movement protein (MP) or CP regions of BCRV and PPV from viral cDNA. Each insert was cloned into pGEM-T Easy (Promega, Madison, WI, USA), purified (NucleoSpin Plasmid Kit, Macherey-Nagel, Düren, Germany), linearized with SalI (Fermentas, Glen Burnie, MD, USA), and cleaned again (NucleoSpin Gel and PCR Clean-up Kit, Macherey-Nagel). In vitro transcription was performed with the MEGAscript T7 Transcription Kit (Invitrogen, Carlsbad, CA, USA), followed by DNase treatment.

Conventional RT-PCR

We validated primer pairs in 20 μL reactions containing 10 μL 2× RT-PCR Premix (Biocube, Seoul, Korea), 1 μL each primer (10 pmol), 1 μL viral RNA transcript (10 ng–10 ag serial dilutions), and 7 μL RNase-free water. Cycling conditions were 95°C for 2 min; 35 cycles of 95°C for 20 s, 55°C for 30 s, 72°C for 1 min; and a final extension at 72°C for 5 min. Products were visualized on agarose gels.

Real-time RT-qPCR

We performed RT-qPCR on a CFX384 system (Bio-Rad, Hercules, CA, USA) in 20 μL reactions with 10 μL 2× Master Mix (Biocube), 10 μM each primer and probe, and 1 μL standard (10 ng–10 ag). Conditions were 48°C for 30 min; 95°C for 10 min; and 40 cycles of 95°C for 10 s, 55°C for 30 s, 72°C for 1 min; followed by 72°C for 5 min.

Primer and probe design

We aligned multiple reference sequences retrieved from NCBI (36 for BCRV; 8 for BlShV; see Fig. 1A, Supplementary Fig. 1) and designed four primer–probe sets per virus targeting conserved regions to yield 100–200 bp amplicons. For BlShV, all of the candidate sets targeted the CP gene. For BCRV and PPV, however, we included both our novel designs and established primer pairs, e.g., Poudel et al. (2014) for BCRV and Fotiou et al. (2019)/Schneider et al. (2004) for PPV. Comparative testing showed that the published primers, demonstrating higher amplification efficiencies (90–110%), lower Cq values, and minimal primer–dimer formation. Therefore, we adopted the published primers for TaqMan probe development for quarantine inspections (Table 2, Fig. 1B). All probes were dual-labeled (FAM–TAMRA or Cy5–BHQ2) to enable multiplexing.

Fig. 1

Designing of the primers and probes. (A) Nucleotide sequence alignments of blueberry shock virus (BlShV) coat protein (CP) used to design the multiplex real-time reverse transcription quantitative PCR primer set for BlShV diagnosis. All BlShV isolates uploaded to NCBI were used for alignment. Arrows indicate primer positions, and numbers indicate nucleotide positions on the consensus sequence. The size of the amplicon is shown below each alignment. (B) Schematic representation of blackberry chlorotic ringspot virus (BCRV), BlShV, and plum pox virus (PPV). The positions of the amplicons are highlighted. (C) The positions of the TaqMan probes that bind to each amplicon. Black arrows indicate primers, and blue arrows indicate probes.

List of primers and probes with its amplicon size

In silico and in vitro specificity

Primer pairs were evaluated using MFEprimer-2.0 (Qu et al., 2012) and BLAST against the host mRNA database to exclude off-target binding. BCRV and PPV primers were then tested on RNA extracted from infected plant tissue, while BlShV assays used synthetic RNA templates, confirming exclusive amplification of target sequences.

PCR efficiency testing

Circular plasmid DNA or in vitro-transcribed RNA standards encompassing each target region were serially diluted tenfold from 10 ng to 10 ag (corresponding to ~40 copies for BCRV/PPV and ~500 copies for BlShV). qRT-PCR assays were run in triplicate for each dilution, and standard curves were generated by plotting log(template concentration) against Cq values to calculate amplification efficiencies and linearity (R2).

Specificity and multiplex assays

We assessed cross-reactivity using RNA from plants infected with six non-target viruses/viroids (BYVaV, BLMV, TRSV, ACLSV, PNSRV, and HSVd). For multiplex detection, BCRV and BlShV probes labeled with FAM and Cy5, respectively, were combined in a single reaction to verify that simultaneous amplification did not compromise sensitivity or accuracy.

Limit of detection and limit of quantification determination

The limit of detection was defined as the lowest concentration yielding a positive result in at least 95% of eight technical replicates. The limit of quantification was set at the lowest concentration that meet the accuracy (±0.25 Ct) and precision (CV ≤ 25%) criteria. We used probit analysis of eight-replicate dilution series for each virus was used to calculate the 95% detection and quantification thresholds.

Results

Selection of primers and probes with high sensitivity and efficiency

We quantified analytical sensitivity using tenfold dilution series of plasmid DNA or in vitro–transcribed RNA standards (10 ng to 10 ag), corresponding to ~40 copies for BCRV/PPV and ~500 copies for BlShV. qRT-PCR with TaqMan probes (Fig. 2) showed limits of detection at these values. Eight-point standard curves exhibited excellent linearity (R2 = 0.999 for BCRV, 0.994 for BlShV, 0.999 for PPV), and calculated PCR efficiencies averaged 99.2% (BCRV set 1), 103.2% (BlShV set 1), and 104.6% (PPV set 2). We adopted Cq < 30 as a practical diagnostic cutoff to balance sensitivity with false-positive risk; under this threshold, detection limits equated to 5 × 103 copies for BCRV, 3 × 104 for BlShV, and 2 × 104 for PPV. Nonetheless, amplification remained observable beyond Cq 30. Together, these data confirm that our final primer–probe combinations meet predefined criteria—90–110% efficiency, R2 ≥ 0.990, and absence of nonspecific amplification—and are thus suitable for routine quarantine diagnostics.

Fig. 2

TaqMan PCR amplification plots and standard curves for blackberry chlorotic ringspot virus (BCRV), blueberry shock virus (BlShV), and plum pox virus (PPV) plasmid DNAs. Amplification plots of BCRV, BlShV, and PPV. FAM fluorescence signals are generated from a dilution series of plasmid DNA. From left to right (red to gray), the curves represent tenfold serial dilutions of the template, 1 ng to 10 ag, performed in three replicates. The standard curve is based on template concentration (logarithmic scale) and detection point.

Specificity testing and multiplex detection

We next verified assay specificity in reactions containing 100 ng of total host RNA. Although host RNA slightly reduced amplification efficiency compared to clean transcript controls—likely due to inhibitors—no signal appeared in negative controls lacking viral templates. Cross-reactivity tests with six unrelated pathogens (BLMV, BYVaV, TRSV, ACLSV, PNSRV, and hop stunt viroid) produced no amplification below Cq 35 (Table 1). For multiplexing, BCRV and BlShV probes were labeled with FAM and Cy5, respectively, and run in simplex or duplex formats (28 template combinations) (Fig. 3, Supplementary Table 1). Duplex reactions exhibited ~1-cycle Cq delays relative to singleplex but retained target-specific amplification and overall stability across varying transcript levels.

Fig. 3

Multiplex detection of blackberry chlorotic ringspot virus (BCRV) and blueberry shock virus (BlShV). Each row represents a type of detection kit. The middle row is for multiplex detection, which simultaneously diagnoses two viruses, while the BCRV and BlShV rows represent simplex detection. Each column indicates the presence or absence of the target RNA transcript of the respective virus. In the middle column, which simulates a mixed infection, only the central cell for multiplex detection shows amplification for both viruses, while the other cells do not exhibit interference between each other.

Detection in woody branch RNA

Finally, we tested performance on total RNA extracted from woody branches of 1–2-year-old seedlings. Increasing host RNA up to 10 ng/μL slightly delayed Cq values but still allowed clear amplification of viral targets, with no nonspecific products on agarose gels (Fig. 4A). Using 2 ng/μL host RNA—optimal for consistent master-mix performance—we determined Cq values of 28.6, 25.1, and 25.1 for the blackberry, blueberry, and peach reference genes (Evagreen dye) (Supplementary Table 2, Supplementary Fig. 2). In mixed-template reactions (host RNA plus in vitro transcripts), detection limits (Cq < 30) corresponded to <4 × 102 copies for BCRV, 5 × 103 for BlShV, and <4 × 102 for PPV (Fig. 4B), demonstrating effective assay functionality under real-world sample conditions.

Fig. 4

Viral sequence detection from RNA mixture with host seedling RNAs. Serial dilutions (1 ng to 10 ag) of RNA transcripts mixed with total RNA from host plants (blackberry, blueberry, peach seedlings) were used as PCR templates. (A) Gel electrophoresis of RT-PCR products. The resulting amplified products were analyzed on a 1.5% agarose gel stained with ethidium bromide. The negative control (NC) consisted only of total RNA from the host plants. The gel images were cropped using PowerPoint to remove extraneous areas from the gel image. (B) Amplification plots of RNA detection of blackberry chlorotic ringspot virus (BCRV), blueberry shock virus (BlShV), and plum pox virus (PPV) in the real-time reverse transcription quantitative PCR assay. Cy5 fluorescence signals are generated from a dilution series. From left to right (red to navy), the curves represent tenfold serial dilutions of RNA transcripts, 1 ng to 10 ag, performed in three replicates.

Discussion

Each year, approximately eighty million tree seedlings are imported into the Republic of Korea, reflecting the country’s growing demand for diversified fruit-tree production (Animal and Plant Quarantine Agency, 2022). Upon arrival, stringent quarantine inspections lead to the destruction or chemical disinfection of 10–15% of consignments, representing substantial economic and logistical burdens for nurseries and quarantine facilities. Despite these measures, the introduction of BCRV and PPV into Korean fruit-tree plantings in 2017 revealed critical gaps in existing detection protocols (Oh et al., 2017; Seo et al., 2017). Both viruses can circulate at low titres—often below visual detection thresholds—and many imported seedlings arrive either in dormant condition or entirely leafless due to transport regulations or seasonal timing, rendering symptom-based diagnostics ineffective.

To address these limitations, we developed a multiplex TaqMan-based real-time RT-qPCR assay capable of simultaneously detecting three quarantine-relevant fruit-tree viruses: BCRV, BlShV, and PPV. Notably, this work represents the first reported TaqMan probe for BlShV, substantially extending molecular diagnostic coverage for this pollen-transmitted Ilarvirus. For BCRV, we leveraged the primer pair originally described by Poudel et al. (2014), updating only the fluorescent probe sequence to accommodate nucleotide variation observed in recently characterized field isolates. For PPV, we incorporated and validated two established primer–probe sets—one developed by Fotiou et al. (2019) for broad-strain detection across major PPV phylogroups, and another by Schneider et al. (2004) targeting highly conserved NIb/CP junctions.

In designing an effective multiplex assay, we adhered to three core performance criteria: (1) absolute specificity for each viral target to avoid cross-amplification, (2) comprehensive coverage of known strain diversity to minimize false negatives, and (3) high analytical sensitivity to detect viral loads as low as those encountered in early or latent infections. We achieved these goals by aligning global MP and CP reference sequences, selecting conserved primer-binding sites, and rigorously evaluating in silico probe–target binding and predicted secondary structures. In vitro testing confirmed amplification efficiencies between 90% and 110% across all targets. Based on typical viral loads in quarantine samples, we established a practical diagnostic cutoff of Cq ≤ 30—which balances sensitivity with the need to limit borderline false-positive signals—while demonstrating that the assay could still detect lower concentrations (up to Cq ~35) when required. Under our conditions, limits of detection were determined to be 40 RNA copies for both BCRV and PPV and 500 copies for BlShV.

To verify analytical specificity, we challenged the assay with six non-target viruses and viroids known to infect Rubus, Vaccinium, and Prunus hosts and observed no unintended amplification. Furthermore, we demonstrated robust duplex and triplex multiplexing using FAM and Cy5 fluorophores: although duplex reactions produced Cq delays of approximately one cycle relative to singleplex, target detection remained accurate across a range of template concentrations.

Consolidating three single-target assays into one multiplex format reduced reagent consumption per sample by roughly 25%, from an estimated $10 USD to $8 USD, while reducing total workflow time from RNA extraction to data analysis to 1.5–2 h. This throughput enables the processing of up to 96 samples in a single day on a 384-well platform, making the approach ideal for high-volume quarantine testing and expediting managerial decisions in certification programs.

Finally, recognizing that quarantine specimens often consist of wood or dormant cuttings lacking green tissue, we validated the assay on total RNA extracted from woody branches at concentrations up to 10 ng/μL. Despite the presence of potential PCR inhibitors, all three viral targets were consistently detected with clear amplification curves and without off-target products.

In summary, our multiplex TaqMan real-time RT-qPCR assay offers a rapid, cost-effective, and highly sensitive solution for simultaneous detection of BCRV, BlShV, and PPV, filling a critical need in Korea’s fruit-tree quarantine framework and enhancing pathogen management in both nursery and production settings.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

We thank Drs. Aiming Wang and Hae-Ryun Kwak for providing us with PPV and BCRV samples, respectively. This work was supported in part by grants from the Animal and Plant Quarantine Agency (RQ20231B004), the Agriculture and Food Convergence Technologies Program for Research Manpower Development, funded by IPET, the Ministry of Agriculture, Food and Rural Affairs (No. RS-2024-00398300), and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (RS-2024-00339085).

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

References

Altieri M. A.. 2018. Agroecology: the science of sustainable agriculture CRC Press. Boca Raton, FL, USA: p. 448.
Animal and Plant Quarantine Agency. 2022. Import and export plant quarantine trends Animal and Plant Quarantine Agency. Gimcheon, Korea:
Barford E.. 2013;Crop pests advancing with global warming. Nature 10:13644.
Beaver-Kanuya E., Harper S. J.. 2020;Development of RT-qPCR assays for the detection of three latent viruses of pome. J. Virol. Methods 278:113836.
Bristow P., Windom G., Martin R.. 2002;Recovery of plants infected with blueberry shock ilarvirus (BlShV). Acta Hortic. 574:85–89.
Bruisson S., Lebel S., Walter B., Prévotat L., Seddas S., Schellenbaum P.. 2017;Comparative detection of a large population of grapevine viruses by TaqMan RT-qPCR and ELISA. J. Virol. Methods 240:73–77.
Fotiou I. S., Pappi P. G., Efthimiou K. E., Katis N. I., Maliogka V. I.. 2019;Development of one-tube real-time RT-qPCR for universal detection and quantification of plum pox virus (PPV). J. Virol. Methods 263:10–13.
Fuchs M., Cox R., Cox K.. 2008. Plum pox disease of stone fruits. Tree Fruit Fact Sheet New York State IPN Program and Cornell University. Ithaca, NY, USA:
Jiao Y., Jiang J., Wu Y., Xia Z.. 2019;Rapid detection of cucumber green mottle mosaic virus in watermelon through a recombinase polymerase amplification assay. J. Virol. Methods 270:146–149.
Jones A. T., McGavin W. J., Gepp V., Zimmerman M. T., Scott S. W.. 2006;Purification and properties of blackberry chlorotic ringspot, a new virus species in subgroup 1 of the genus Ilarvirus found naturally infecting blackberry in the UK. Ann. Appl. Biol. 149:125–135.
Jung M., Kim N. H., Oh S. H., Kim K.-H.. 2024;Development of a TaqMan-based real-time qPCR method for accurate detection and quantification of citrus psorosis virus and cytoplasmic-type citrus leprosis virus in saplings. Plant Pathol. J. 40:625–632.
MacDonald S. G., Martin R. R., Bristow P. R.. 1991;Characterization of an ilarvirus associated with a necrotic shock reaction in blueberry. Phytopathology 81:210–214.
Mackay I. M., Arden K. E., Nitsche A.. 2002;Real-time PCR in virology. Nucleic Acids Res. 30:1292–1305.
Menzel W., Jelkmann W., Maiss E.. 2002;Detection of four apple viruses by multiplex RT-PCR with co-amplification of plant mRNA as internal control. J. Virol. Methods 99:81–92.
Oh J. H., Park C. Y., Lee H.-K., Yeom Y.-A., Lim S. M., Moon J.-S., Lee S.-H.. 2017;First report of plum pox virus strain D isolate in peach (Prunus persica) in Korea. Plant Dis. 101:265.
Poudel B.. 2011. Epidemiological studies on blackberry yellow vein associated virus and blackberry chlorotic ringspot virus. Ph.D. thesis University of Arkansas; Fayetteville, AR, USA:
Poudel B., Ho T., Laney A., Khadgi A., Tzanetakis I. E.. 2014;Epidemiology of blackberry chlorotic ringspot virus. Plant Dis. 98:547–550.
Qu W., Zhou Y., Zhang Y., Lu Y., Wang X., Zhao D., Yang Y., Zhang C.. 2012;MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity. Nucleic Acids Res. 40:W205–W208.
Schneider W. L., Sherman D. J., Stone A. L., Damsteegt V. D., Frederick R. D.. 2004;Specific detection and quantification of plum pox virus by real-time fluorescent RT-PCR. J. Virol. Methods 120:97–105.
Seo J.-K., Kim M.-K., Kwak H.-R., Choi H.-S.. 2017;First report of blackberry chlorotic ringspot virus in black raspberry (Rubus coreanus) in Korea. Plant Dis. 101:848.

Article information Continued

Fig. 1

Designing of the primers and probes. (A) Nucleotide sequence alignments of blueberry shock virus (BlShV) coat protein (CP) used to design the multiplex real-time reverse transcription quantitative PCR primer set for BlShV diagnosis. All BlShV isolates uploaded to NCBI were used for alignment. Arrows indicate primer positions, and numbers indicate nucleotide positions on the consensus sequence. The size of the amplicon is shown below each alignment. (B) Schematic representation of blackberry chlorotic ringspot virus (BCRV), BlShV, and plum pox virus (PPV). The positions of the amplicons are highlighted. (C) The positions of the TaqMan probes that bind to each amplicon. Black arrows indicate primers, and blue arrows indicate probes.

Fig. 2

TaqMan PCR amplification plots and standard curves for blackberry chlorotic ringspot virus (BCRV), blueberry shock virus (BlShV), and plum pox virus (PPV) plasmid DNAs. Amplification plots of BCRV, BlShV, and PPV. FAM fluorescence signals are generated from a dilution series of plasmid DNA. From left to right (red to gray), the curves represent tenfold serial dilutions of the template, 1 ng to 10 ag, performed in three replicates. The standard curve is based on template concentration (logarithmic scale) and detection point.

Fig. 3

Multiplex detection of blackberry chlorotic ringspot virus (BCRV) and blueberry shock virus (BlShV). Each row represents a type of detection kit. The middle row is for multiplex detection, which simultaneously diagnoses two viruses, while the BCRV and BlShV rows represent simplex detection. Each column indicates the presence or absence of the target RNA transcript of the respective virus. In the middle column, which simulates a mixed infection, only the central cell for multiplex detection shows amplification for both viruses, while the other cells do not exhibit interference between each other.

Fig. 4

Viral sequence detection from RNA mixture with host seedling RNAs. Serial dilutions (1 ng to 10 ag) of RNA transcripts mixed with total RNA from host plants (blackberry, blueberry, peach seedlings) were used as PCR templates. (A) Gel electrophoresis of RT-PCR products. The resulting amplified products were analyzed on a 1.5% agarose gel stained with ethidium bromide. The negative control (NC) consisted only of total RNA from the host plants. The gel images were cropped using PowerPoint to remove extraneous areas from the gel image. (B) Amplification plots of RNA detection of blackberry chlorotic ringspot virus (BCRV), blueberry shock virus (BlShV), and plum pox virus (PPV) in the real-time reverse transcription quantitative PCR assay. Cy5 fluorescence signals are generated from a dilution series. From left to right (red to navy), the curves represent tenfold serial dilutions of RNA transcripts, 1 ng to 10 ag, performed in three replicates.

Table 1

List of plant and virus materials and their Cq value from the detection set

Plant species Pathogena Detection set (Cq)b Source


Species Isolate BCRV BlShV PPV
Tobacco (Nicotiana benthamiana) Healthy N/A N/A N/A
TRSV PV-0180 N/A N/A N/A NIAS, KR
Blackberry (Rubus coreanus) Healthy N/A N/A - NIHHS, KR
BYVaV KNU-V1012-2 N/A 37.68 ± 0.17 - NIAS, KR
Blueberry (Vaccinium section Cyanococcus) Healthy N/A N/A - NIHHS, KR
BCRV CV201130-8 25.90 ± 0.04 N/A - NIAS, KR
BLMV GC-15 N/A N/A - NIAS, KR
Peach (Prunus persica) Healthy - - N/A NIHHS, KR
PPV VPH (D strain) - - 16.80 ± 0.11 Dr. A. Wang
HSVd Unknown - - 38.76 ± 0.22 NIHHS, KR
ACLSV Unknown - - 38.08 ± 0.32 NIHHS, KR
PNSRV CS - - 37.42 ± 0.78 NIHHS, KR

BlShV, blueberry shock virus; NIAS, National Institute of Agricultural Sciences; NIHHS, National Institute of Horticultural and Herbal Science.

a

The following viruses were identified: tobacco ringspot virus (TRSV), blackberry yellow vein associated virus (BYVaV), blackberry chlorotic ringspot virus (BCRV), blueberry leaf mottle virus (BLMV), plum pox virus (PPV), apple chlorotic leaf spot virus (ACLSV), prunus necrotic ringspot virus (PNSRV), and hop stunt viroid (HSVd). The RNA was extracted from the leaves and branches of healthy and infected hosts.

b

N/A indicates amplification below the detection threshold. The mean value and standard deviation are presented from at least three technical repeats.

Table 2

List of primers and probes with its amplicon size

Target virus Primer (5′→3′)a Probe (5′→3′)a Amplicon size (bp) Reference
BCRV AGGTTGAAATGGCTTTGACCC 1) CTGTCACAGAAGCTCTCGCTGGTTC 138 Primers adapted from Oh et al. (2021)
AAGCAGCRCATCGCCTTATAC 2) GAAGCTCTCGCTGGTTCGATGGAGC
BlShV TTGGAGTACGATAAGTTCTCCGAAG 1) CGTACAAATCCCTAGTCATGACCAC 125
ATNCGTACCCGTGGTAGACTAGA 2) TTCGAATTTAAGTCTGACTACCCGATAGG
PPV CCAATAAAGCCATTGTTGGATC 1) TCAGCCACGTTACTGAAATGTGCC 131 Seo et al. (2017)
TGAATTCCATACCTTGGCATGT
CACAAGTGGARTATCCAATAAAGCCATTG 2) CACATTTCAGTAACGBGCTGAAGCG 146 Qu et al. (2012)
CTGAATTCCATACCTTGGCATGTATGC
a

For blackberry chlorotic ringspot virus (BCRV), the coding region of the movement protein is targeted. For blueberry shock virus (BlShV) and plum pox virus (PPV), however, the coding region of the coat protein is targeted. The probes were tested with two dye-quencher sets: FAM-TAMRA and Cy5-BHQ2.