Plant Pathol J > Volume 42(1); 2026 > Article
Jang, Mannaa, Lee, Jeong, Lee, and Seo: The Nitrogen Regulatory Gene ntrC Modulates Virulence and Nitrogen Metabolism in Burkholderia glumae

Abstract

Burkholderia glumae, the causal agent of bacterial panicle blight in rice, is a major threat to global rice production. Although the NtrB-NtrC two-component system is a well-established regulator of nitrogen assimilation in many bacteria, its role in B. glumae has remained undefined. In this study, we constructed a ntrC deletion mutant of B. glumae BGR1 to investigate the contribution of NtrC to nitrogen metabolism and virulence. Under nitrogen-limited conditions in minimal medium supplemented with a single nitrogen source, the mutant exhibited markedly impaired growth, particularly when ammonium or glutamine served as the sole nitrogen source. Loss of ntrC also resulted in significant reductions in swimming motility, biofilm formation, and toxoflavin production, while extracellular protease activity was unaffected. In pathogenicity assays, the mutant caused substantially milder symptoms in both rice seedlings and flowering panicles, despite showing no difference in bacterial population levels in planta compared with the wild-type. These findings demonstrate that NtrC is essential for efficient nitrogen utilization and for full virulence expression in rice. This study provides evidence that the NtrB-NtrC system links nitrogen metabolism with virulence expression in B. glumae.

Bacterial panicle blight (BPB) is a devastating rice disease that poses a growing threat to global food security. First described in Japan in the 1950s (Goto, 1956; Zhou-qi et al., 2016), BPB has since been reported across major rice-producing regions, including East and Southeast Asia (Chien and Chang, 1987; Jeong et al., 2003), the Americas (Shahjahan et al., 2000), and Africa (Zhou, 2014). Epidemics are typically associated with hot and humid climates, particularly under prolonged high nighttime temperatures that favor pathogen proliferation (Nandakumar et al., 2009; Ortega and Rojas, 2021; Shew et al., 2019). Among the bacterial species implicated, Burkholderia glumae is recognized as the primary causal agent (Goto et al., 1987; Kurita, 1967). This pathogen infects rice panicles, grains, and seedlings, resulting in grain rot, sterility, and severe yield losses. Its incidence and geographic range are projected to expand under ongoing global warming (Ortega and Rojas, 2021; Shew et al., 2019).
The pathogenicity of B. glumae is multifactorial, involving virulence traits such as motility, biofilm formation, and the secretion of extracellular enzymes and phytotoxins (Kim et al., 2023; Mannaa et al., 2018; Suzuki et al., 2004; Zhou, 2014). Among these factors, toxoflavin—a yellow, diffusible toxin regulated by quorum sensing—plays a central role in disease symptom development, inducing chlorosis and necrosis in rice and other hosts (Jeong et al., 2003; Li et al., 2019). The biosynthesis of toxoflavin and other virulence factors is strongly influenced by temperature (Suzuki et al., 2004; Zhou, 2014). This thermal responsiveness supports B. glumae adaptation to tropical environments and links its virulence to climate-associated warming trends.
Beyond environmental factors, nutrient availability—particularly nitrogen—plays a critical role in modulating plant-pathogen interactions. Within host tissues, nitrogen is often scarce and unevenly distributed, serving not only as a metabolic limitation but also as a regulatory signal that triggers virulence gene expression (Fagard et al., 2014; Snoeijers et al., 2000). In Pseudomonas syringae, alterations in nitrogen assimilation pathways influence infection success through differential expression of glutamine synthetase isoforms (Pérez-García, 1995; Pérez-García et al., 1998). Similarly, in the fungal pathogen Fusarium oxysporum, nitrogen starvation activates the TOR-MeaB pathway, enhancing the expression of virulence-related genes and promoting host colonization (López-Berges et al., 2010). These findings underscore nitrogen metabolism as a central regulatory node that integrates metabolic state with pathogenic behavior.
In bacteria, nitrogen status is primarily sensed and transduced by the NtrB-NtrC two-component regulatory system, which governs the assimilation of nitrogen sources such as ammonium and glutamine into glutamate (Leigh and Dodsworth, 2007; Merrick and Edwards, 1995). NtrC functions as a σ54-dependent transcriptional activator controlling glnA, encoding glutamine synthetase, and other genes required for nitrogen assimilation and adaptive metabolism (Leigh and Dodsworth, 2007; North et al., 2023). Beyond its canonical metabolic role, NtrC has been implicated in diverse processes including stress adaptation, motility, and virulence in several bacterial pathogens. For example, Brucella suis ΔntrC mutants display impaired intracellular survival and attenuated virulence in animal models (Dorrell et al., 1999). In P. aeruginosa, the NtrBC system modulates invasiveness and pathogenicity during high-density infections (Alford et al., 2020), while in Vibrio vulnificus, NtrC regulates exopolysaccharide synthesis and biofilm development (Kim et al., 2009). Likewise, Acidovorax citrulli relies on NtrC for nitrogen utilization, biofilm formation, and full virulence expression in planta (Liu et al., 2023). Collectively, these studies highlight NtrC as a global integrator linking metabolic adaptation with virulence regulation.
Despite these insights, the specific contribution of NtrC to B. glumae pathogenicity remains poorly understood. As B. glumae encounters nitrogen limitation within the apoplast and spikelet tissues of rice (Fagard et al., 2014; Ortega and Rojas, 2021), nitrogen sensing and assimilation likely play key roles in coordinating virulence expression and host adaptation. Elucidating this regulatory interplay is essential for understanding how B. glumae thrives and causes disease under nutrient-limited and thermally stressful environments.
This study aimed to elucidate the role of the nitrogen response regulator NtrC in B. glumae BGR1, with emphasis on its contribution to nitrogen metabolism and virulence regulation. Specifically, we examined how ntrC disruption affects bacterial growth under different nitrogen sources and its influence on motility, biofilm formation, and toxoflavin production. We also evaluated the impact of ntrC deletion on disease development in rice to clarify how NtrC contributes to the pathogenic process. These objectives were intended to advance understanding of the molecular mechanisms that couple nitrogen sensing with virulence regulation in B. glumae.

Materials and Methods

Bacterial strains, plasmids, and culture conditions

The bacterial strains and plasmids used in this study are listed in Table 1. B. glumae BGR1 was used as the wild-type strain. The ntrC deletion mutant (ΔntrC) and complemented strain (CntrC) were generated in this study. Escherichia coli DH5α λpir and E. coli S17-1 λpir were used for plasmid construction and mobilization, respectively.
All B. glumae and E. coli strains were routinely cultured in Luria-Bertani (LB) broth or on LB agar at 37°C. When required, antibiotics were added at the following concentrations: rifampicin, 100 μg mL−1; kanamycin, 30 or 50 μg mL−1; and benomyl, 50 μg mL−1. Antibiotics were used individually or in combination for plasmid selection or strain maintenance. For long-term preservation, bacterial cultures were stored at −80°C in LB broth containing 20% (v/v) glycerol.

Construction of the ΔntrC mutant and complemented strain

Genomic DNA was extracted from B. glumae BGR1 using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Plasmid DNA was isolated with the HiGene™ Plasmid Mini Prep Kit (BIOFACT, Daejeon, Korea). DNA concentration and purity were measured using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Polymerase chain reaction (PCR) amplifications were performed using Pfu-X DNA Polymerase (Solgent, Daejeon, Korea) in an Eppendorf Pro S vapo.protect thermocycler. Primer sequences and their corresponding target regions are listed in Table 2.
The ΔntrC mutant and its complemented strain were generated following standard molecular cloning techniques (Green and Sambrook, 2012). For gene deletion, the upstream (L) and downstream (R) flanking regions of ntrC were amplified from B. glumae BGR1 genomic DNA using primers carrying appropriate restriction sites (Table 2). The two fragments were fused by overlap-extension PCR to obtain a continuous LR fragment, which was cloned into the suicide vector pK18mobsacB (Schäfer et al., 1994). The recombinant plasmid was first propagated in E. coli DH5α λpir and screened on kanamycin-containing LB agar using blue-white selection. Verified constructs were transferred to E. coli S17-1 λpir, which served as the donor strain for biparental conjugation with B. glumae BGR1 (Simon et al., 1983). Transconjugants were selected on LB agar containing rifampicin (for B. glumae) and kanamycin (for the plasmid).
Single-crossover recombinants were obtained via homologous recombination at the ntrC locus. Double-crossover events leading to an unmarked deletion were selected by repeated subculturing on LB agar supplemented with 20% sucrose for sacB-based counterselection. Sucrose-resistant, kanamycin-sensitive colonies were screened by PCR to confirm the loss of ntrC.
For genetic complementation, the full open reading frame of ntrC was amplified and cloned into the broad-host-range vector pBBR1MCS-2 (Kovach et al., 1995). The recombinant plasmid was introduced into the ΔntrC mutant by electroporation. Transformants were selected on LB agar containing rifampicin and kanamycin, and successful complementation was verified by PCR amplification and Sanger sequencing (Macrogen, Seoul, Korea).

Growth characterization under nutrient-rich and nitrogen-limited conditions

To evaluate the role of NtrC in growth regulation under different nutrient conditions, B. glumae BGR1 (wild-type), ΔntrC, and CntrC strains were cultured in nutrient-rich and nitrogen-limited media. For nutrient-rich conditions, bacterial growth was monitored in LB broth at 37°C with shaking at 200 rpm.
For nitrogen-limited conditions simulating the rice apoplastic environment, a minimal medium (MM) was used as the basal formulation containing 30 g L−1 sucrose, 1 g L−1 KH2PO4, 0.5 g L−1 MgSO4·7H2O, 0.5 g L−1 KCl, and 0.2 mL L−1 of a trace element solution (Table 3). Nitrogen limitation was imposed by supplementing MM with a single nitrogen source (3 mM), either ammonium sulfate (MM-AS) or glutamine (MM-Gln).
Overnight bacterial cultures were washed twice with sterile 1 mM MgSO4 and adjusted to an initial optical density of 0.05 at 600 nm (OD600). Cultures were incubated at 37°C with shaking, and optical density was recorded at designated time points over a 48 h period using a spectrophotometer. Each experiment was performed in triplicate with three independent biological replicates.

Pathogenicity assays in rice

The virulence of B. glumae BGR1 wild-type, ΔntrC mutant, and complemented (CntrC) strains was evaluated on rice (Oryza sativa L. cv. Dongjin) at the flowering stage. Bacterial suspensions were prepared in 1 mM MgSO4 and adjusted to an optical density (OD600) of 0.8. Rice panicles were immersed in 35 mL of the bacterial suspension for 1 min, while 1 mM MgSO4 served as the negative control. Plants were maintained under greenhouse conditions at 37°C and nearly 100% relative humidity at the Department of Southern Area Crop Science, National Institute of Crop Science (Miryang, Korea).
Disease symptoms were assessed 14 days post-inoculation (dpi). Disease severity was determined using the panicle blight index (Kim et al., 2023), rated on a 0-5 scale: 0 = no symptoms, 5 = severe panicle blight (80-100% of the panicle affected). Thirty panicles were used per treatment, and disease severity was calculated as:
Disease severity=Σ(number of samples per rating rating value)total number of panicles
To assess virulence during early infection, O. sativa L. cv. Dongjin seeds (Korea Seed & Variety Service, Gimcheon, Korea) were used in a seedling blight assay. Bacterial suspensions (OD600 = 0.8 in 1 mM MgSO4) were prepared, and 30 seeds were soaked in 15 mL of suspension for 24 h at 37°C with shaking (200 rpm). Seeds were then transferred to sterile containers and germinated at 30°C for 3 days, followed by growth for 7 days under a 12 h light/12 h dark cycle (25°C day/22°C night). Control seedlings were treated with 1 mM MgSO4 only. Disease severity was assessed by measuring shoot and root lengths relative to controls. Each treatment included 30 seedlings.

Evaluation of virulence attenuation and in planta bacterial colonization

The rice seedling infection assay was repeated under controlled growth conditions, and disease severity was recorded at 10 dpi. Shoot and root lengths were measured to quantify growth inhibition relative to the control. To examine whether the virulence attenuation of the ΔntrC mutant was associated with reduced colonization, bacterial population densities were quantified in infected seedlings at 0 and 10 dpi. Ten seedlings per treatment were homogenized in 20 mL sterile 1 mM MgSO4 using a pre-chilled mortar and pestle. Homogenates (100 μL) were serially diluted, and 3 μL from each dilution was spotted on LB agar plates containing rifampicin (100 μg mL−1), kanamycin (50 μg mL−1), and benomyl (50 μg mL−1) to selectively recover B. glumae BGR1. Plates were incubated at 37°C for 24 h, and colony-forming units (CFU) were counted to calculate bacterial populations (CFU mL−1). Each assay was performed in three independent experiments with three biological replicates.

Assessment of swimming motility and biofilm formation

Swimming motility was assessed on MM supplemented with 3 mM glutamine (MM-Gln) and solidified with 0.3% (w/v) agar. Overnight cultures were grown in LB broth at 37°C with shaking (200 rpm) and adjusted to OD600 = 0.5. Ten milliliters of each culture were centrifuged at 7,000 × g for 3 min, washed twice with sterile 1 mM MgSO4, and resuspended in 100 μL of the same solution. A 3 μL aliquot was inoculated onto the center of each MM-Gln motility plate (Kim et al., 2023; Nickzad et al., 2015). Plates were incubated at 37°C for 48 h, and motility zone diameters were measured in millimeters. Each experiment was performed in triplicate.
Biofilm formation was quantified using a modified crystal violet assay (Ball et al., 2022; Vestby et al., 2020). Overnight cultures were centrifuged at 7,000 ×g for 3 min, washed twice with 1 mM MgSO4, and resuspended in MM-Gln medium to OD600 = 0.05. A 250 μL aliquot of each suspension was added to sterile 96-well polystyrene plates and incubated at 37°C for 2 days without shaking. After incubation, planktonic cells were removed, and wells were gently washed twice with sterile distilled water. Plates were air-dried at 50°C for 30 min and stained with 0.1% (w/v) crystal violet for 15 min. Excess stain was removed by four washes with distilled water, followed by air drying for 20 min. Bound crystal violet was solubilized in 30% (v/v) acetic acid for 15 min, and absorbance was recorded at 570 nm (Kamimura et al., 2022; O’Toole, 2011). Biofilm biomass was expressed as the mean absorbance from three independent experiments, each with three technical replicates. To verify that differences in biofilm formation were not due to reduced growth under nitrogen-limited conditions, an additional assay was performed using cultures adjusted to a high initial density. Overnight LB cultures were washed twice with sterile MgSO4 and normalized to OD600 = 1.0 before inoculation into MM-Gln medium. Biofilm formation was assessed as described above.

Protease activity and toxoflavin production

Proteolytic activity was measured on MM + 3 mM Gln supplemented with 1% (w/v) skim milk (BD Difco, Franklin Lakes, NJ, USA). Overnight cultures were adjusted to OD600 = 1.0, and 10 μL aliquots were inoculated into 4 mm wells made in the agar using a sterile cork borer. Plates were incubated at 37°C for 3 days, and protease activity was quantified by measuring the diameter of the clear zones around inoculation sites (Jung et al., 2025).
Toxoflavin production was quantified using a modified thin-layer chromatography (TLC) method (Kim et al., 2004; Kim et al., 2023; Lee et al., 2016). Strains were cultured in 4 mL MM-Gln for 12 h at 37°C with shaking (200 rpm). Cultures were centrifuged at 7,000 ×g for 3 min, and supernatants were extracted twice with equal volumes of chloroform. The organic phase was collected, centrifuged at 13,000 ×g for 10 min, and evaporated under vacuum for 20 min using a centrifugal concentrator. Dried extracts were resuspended in methanol and spotted onto silica-gel TLC plates (Merck, Germany). Toxoflavin was visualized under UV light (365 nm), and bands were imaged. For quantitative analysis, methanol-dissolved extracts were measured spectrophotometrically at 393 nm (Li et al., 2019). The OD600 of each culture was recorded in parallel, and toxoflavin levels were expressed as Abs393/OD600 to normalize for differences in growth. Data represent mean ± standard deviation (SD) from three independent experiments.

Statistical analysis

All experiments were conducted at least twice, with three biological replicates per treatment unless otherwise specified. Statistical analyses were performed using SAS (Statistical Analysis System; SAS Institute, Cary, NC, USA). Analysis of variance was carried out using the General Linear Model procedure, and mean separation was performed using Tukey’s Honestly Significant Difference (HSD) test at P < 0.05. Data are presented as the mean ± standard deviation.

Results

NtrC is essential for growth under nitrogen-limited conditions

The ΔntrC mutant exhibited a pronounced growth defect under nitrogen-limited conditions compared with the wild-type and complemented (CntrC) strains. In nutrient-rich LB medium, all strains displayed similar growth kinetics, indicating that NtrC is dispensable for proliferation when nitrogen is readily available (Fig. 1A). In contrast, under nitrogen-limiting conditions in MM supplemented with a single nitrogen source, the mutant showed a marked impairment. When either ammonium sulfate (MM-AS) or glutamine (MM-Gln) was supplied at 3 mM, the ΔntrC strain consistently failed to reach the optical densities achieved by the WT and CntrC strains during 48 h of incubation (Fig. 1B and C). Restoration of growth in the complemented strain confirmed that this phenotype resulted specifically from ntrC disruption. These findings demonstrate that NtrC is indispensable for efficient assimilation of ammonium and glutamine—key substrates in bacterial nitrogen metabolism—and highlight its critical role in sustaining growth under nitrogen scarcity that mimics the host apoplastic environment.

NtrC is required for virulence of B. glumae in rice

Loss of ntrC significantly compromised the virulence of B. glumae in both flowering and seedling infection assays. In the panicle assay, plants inoculated with the ΔntrC mutant exhibited visibly reduced symptoms compared with those inoculated with the wild-type, whereas the complemented strain restored symptom severity to wild-type levels (Fig. 2A-C). Quantitative scoring using the panicle blight index confirmed a substantial reduction in disease severity for the mutant, indicating that NtrC is required for effective colonization and symptom development in rice spikelets.
Consistent results were obtained in the seedling blight assay. Wild-type and CntrC infections caused pronounced inhibition of shoot and root elongation, while seedlings inoculated with the ΔntrC mutant showed only mild stunting and limited root necrosis (Fig. 2D-F). Collectively, these observations establish that NtrC is indispensable for the full virulence of B. glumae BGR1 during both early and late stages of infection. The restoration of pathogenicity in the complemented strain further confirms that the observed attenuation results directly from ntrC deletion rather than secondary mutations.

Virulence reduction in the ΔntrC mutant is not associated with reduced in planta bacterial growth

Although the ΔntrC mutant caused markedly milder disease symptoms, it was unclear whether this attenuation resulted from impaired bacterial proliferation within host tissues. To address this, bacterial population dynamics were quantified in infected rice seedlings.
However, enumeration of bacterial populations revealed no significant differences in CFU counts between the wild-type and ΔntrC strains at either the initial inoculation (0 dpi) or at 10 dpi (Fig. 3A and B). These results indicate that NtrC does not affect bacterial survival or multiplication in planta. The reduced virulence of the ΔntrC mutant therefore reflects a regulatory impairment that disrupts the expression or activation of virulence-associated traits, rather than a defect in colonization or persistence within host tissues.

NtrC influences colonization-related virulence factors in minimal medium with glutamine

Efficient colonization of host tissues by B. glumae relies on motility for surface exploration and biofilm formation for stable attachment and persistence. When tested in MM-Gln, the ΔntrC mutant exhibited reduction in swimming motility compared with the wild-type strain (Fig. 4A and B). Motility was restored in the complemented strain (CntrC), reaching levels comparable to wild-type.
Similarly, biofilm formation was reduced in the ΔntrC mutant compared with the wild-type under nitrogen-limited conditions (Fig. 4C and D). Because the initial inoculum (OD600 = 0.05) might allow growth defects to influence attachment, we repeated the assay using cultures adjusted to an OD600 of 1.0 prior to inoculation to minimize growth-dependent effects. The ΔntrC mutant still showed significantly reduced biofilm formation under these conditions, confirming that this phenotype is not solely attributable to impaired growth (Supplementary Fig. 1). These results demonstrate that NtrC positively regulates both swimming motility and biofilm formation under nitrogen-limited conditions. Given the importance of these traits during the early stages of rice infection, the observed attenuation of virulence in the ΔntrC mutant likely results, at least in part, from impaired colonization capacity.

NtrC regulates toxoflavin biosynthesis but not extracellular protease activity

To determine whether NtrC also affects virulence factors associated with later stages of infection, extracellular protease secretion and toxoflavin biosynthesis were examined. The ΔntrC mutant exhibited protease activity comparable to that of the wild-type and CntrC strains, as indicated by similar clear zone diameters on skim milk agar plates (Fig. 5A and B). These findings suggest that NtrC does not contribute to the regulation of extracellular protease production, a function commonly linked to host tissue maceration.
In contrast, toxoflavin synthesis was markedly reduced in the ΔntrC mutant compared with wild-type. The TLC analysis revealed substantially weaker toxoflavin bands in mutant extracts, whereas complementation restored the band intensity to near WT levels (Fig. 5C). Quantitative spectrophotometric measurements at 393 nm further confirmed a significant decrease in toxoflavin accumulation in the mutant (Fig. 5D). Together, these results identify NtrC as a positive regulator of toxoflavin biosynthesis but not of extracellular protease secretion, underscoring its selective role in modulating key secondary metabolites essential for B. glumae virulence.

Discussion

Nutrient sensing plays a decisive role in shaping the infection strategies of B. glumae, the causal agent of bacterial panicle blight. This study identifies the nitrogen-responsive regulator NtrC as a central factor that links nitrogen assimilation with the expression of key virulence-associated traits in B. glumae BGR1. Disruption of ntrC impaired growth on ammonium and glutamine, reduced motility and biofilm formation, and markedly decreased toxoflavin production, resulting in attenuated virulence in rice. These findings collectively position NtrC as a pivotal link between nitrogen metabolism and pathogenicity.
The inability of the ΔntrC mutant to grow efficiently on ammonium or glutamine confirms that NtrC fulfills its canonical role in nitrogen assimilation, consistent with its function in other Gram-negative bacteria (Leigh and Dodsworth, 2007; Merrick and Edwards, 1995). In E. coli and Caulobacter crescentus, NtrC activates σ54-dependent transcription of glnA and other genes essential for converting ammonium and glutamine into glutamate—the core metabolite of nitrogen metabolism (Leigh and Dodsworth, 2007; North et al., 2023). Comparable phenotypes have been reported in B. suis and A. citrulli, where ntrC mutants display amino-acid utilization defects and reduced competitiveness in nutrient-limited or host environments (Dorrell et al., 1999; Liu et al., 2023). Extending these observations to B. glumae, our results indicate that NtrC is indispensable for maintaining nitrogen homeostasis under apoplast-like conditions, where available nitrogen is scarce and unevenly distributed (Fagard et al., 2014).
Although nitrogen assimilation strongly influences cellular physiology, the reduction in virulence observed in the ΔntrC mutant cannot be attributed solely to impaired growth. Bacterial enumeration revealed comparable population densities between the wild-type and mutant strains within infected seedlings, even though symptom development was significantly reduced. This uncoupling of bacterial load from disease severity implies that NtrC is required for full expression of specific virulence determinants rather than affecting survival or replication directly. Similar regulatory dissociations have been documented in other pathogens, where transcriptional defects suppress virulence expression without compromising bacterial proliferation (Jeong et al., 2003; Liu et al., 2023; Marunga et al., 2022). In B. glumae, whose success depends on the timely activation of energetically demanding virulence factors, our data are consistent with a model in which NtrC helps coordinate the expression of these traits with nitrogen availability, although additional work will be required to define this regulatory role in detail.
Motility and adhesion are essential for host colonization, enabling bacterial penetration and establishment within plant tissues (Mannaa et al., 2018). The pronounced reduction in swimming motility and biofilm formation observed in the ΔntrC mutant under nitrogen-limited conditions indicates that NtrC-mediated signaling influences these surface-associated behaviors. Nitrogen-responsive regulation of motility appears to be conserved across diverse bacterial taxa: in P. aeruginosa, the NtrBC system modulates flagellar gene expression and enhances invasiveness (Alford et al., 2020), whereas in V. vulnificus, NtrC promotes exopolysaccharide synthesis and biofilm formation (Kim et al., 2009). Likewise, A. citrulli requires NtrC for robust biofilm development and full virulence (Liu et al., 2023). The reduced biofilm phenotype remained evident even when assays were initiated with a high-density inoculum, indicating that the defect is not an indirect consequence of impaired growth but reflects a functional requirement for NtrC in biofilm development. Given that motility and biofilm formation are prerequisites for efficient colonization of rice tissues (Nickzad et al., 2015; Vestby et al., 2020), our findings suggest that NtrC coordinates early infection processes by integrating nutrient-sensing signals with the regulation of flagellar and adhesion systems.
A major outcome of this work is the discovery that NtrC selectively contributes to toxoflavin biosynthesis, a defining virulence factor of B. glumae. The strong reduction in toxoflavin accumulation in the ΔntrC mutant provides a mechanistic explanation for its attenuated virulence phenotype. Toxoflavin biosynthesis, governed by the tox operon (Suzuki et al., 2004), is tightly controlled through quorum sensing and global regulatory networks (Jeong et al., 2003; Kim et al., 2023). NtrC may influence this pathway directly via σ54-dependent regulation or indirectly through metabolic feedbacks linking nitrogen flux to secondary metabolism. The observation that extracellular protease activity remained unchanged further demonstrates that NtrC exerts selective, rather than global, regulatory control. This specificity supports the concept that metabolic regulators fine-tune discrete virulence modules to balance resource allocation and infection efficiency (Fagard et al., 2014).
Taken together, these findings identify NtrC as a metabolic-regulatory hub that synchronizes nitrogen assimilation with virulence gene expression. Comparable nutrient-pathogenicity cross-talk has been described in other plant and fungal pathogens, where nitrogen limitation serves as a cue to activate virulence programs (López-Berges et al., 2010; Snoeijers et al., 2000). In B. glumae, which encounters nitrogen-poor microenvironments within rice tissues (Ortega and Rojas, 2021), NtrC likely functions as an integrator that (i) activates nitrogen assimilation to maintain growth, (ii) promotes motility and adhesion during colonization, and (iii) triggers toxoflavin biosynthesis once metabolic sufficiency is achieved. This hierarchical regulation ensures that virulence deployment is energetically optimized and environmentally responsive—hallmarks of adaptive pathogenic strategies. Because we did not directly profile NtrC-dependent transcription, the specific genes and pathways under its control in B. glumae remain to be defined
In summary, this work provides the first comprehensive evidence that NtrC acts as a dual regulator of nitrogen metabolism and virulence in B. glumae. By linking primary metabolism with pathogenic signaling, NtrC enables the bacterium to fine-tune infection processes according to host nutrient conditions. Future studies employing transcriptomic and ChIP-based analyses under host-mimicking environments should delineate the NtrC regulon and its σ54-dependent targets (North et al., 2023). Integrating such data with metabolomic profiling will further elucidate how nitrogen flux is converted into regulatory signals that control virulence expression. These insights may ultimately inform the development of novel disease-management strategies targeting nitrogen-sensing networks to mitigate bacterial panicle blight.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by a two-year Research Grant from Pusan National University (Y.-S. S.).

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

Fig. 1
Growth of Burkholderia glumae BGR1 wild-type (WT), ΔntrC mutant, and complemented strain (CntrC) under nutrient-rich and nitrogen-limited conditions. (A) Growth curves of WT, ΔntrC, and CntrC strains in Luria-Bertani (LB) broth. All strains exhibited comparable growth, indicating that NtrC is dispensable under nutrient-rich conditions. (B) Growth in minimal medium (MM) supplemented with 3 mM ammonium sulfate (MM-AS) as the sole nitrogen source. The ΔntrC mutant showed markedly impaired growth compared with WT and CntrC. (C) Growth in MM supplemented with 3 mM glutamine (MM-Gln). Similar to the ammonium condition, the ΔntrC mutant displayed significantly reduced growth, while the complemented strain restored growth to near WT levels. Optical density at 600 nm (OD600) was recorded at different time points over a 48 h incubation at 37°C. Data represent the mean ± standard deviation from three biological replicates. Different lowercase letters at each time point denote statistically significant differences among strains according to Tukey’s Honestly Significant Difference test (P < 0.05).
ppj-oa-11-2025-0166f1.jpg
Fig. 2
Pathogenicity of Burkholderia glumae BGR1 wild-type (WT), ΔntrC mutant, and complemented strain (CntrC) in rice at the flowering and seedling stages. (A) Photographs representing flowering panicles of rice inoculated with WT, ΔntrC, or CntrC strains, showing disease symptoms 14 days post-inoculation (dpi). (B, C) Quantification of disease severity in flowering assays using a panicle blight index ranging from 0 (no visible symptoms) to 5 (severe panicle blight). (D) Photographs representing rice seedlings inoculated with WT, ΔntrC, or CntrC strains at the coleoptile stage; symptoms were recorded 7 dpi. (E, F) Quantitative assessment of seedling blight based on inhibition of shoot (E) and root (F) elongation relative to the control. Bars represent mean ± standard deviation from three independent experiments (n = 30 plants per treatment). Different lowercase letters above bars indicate statistically significant differences among strains according to Tukey’s Honestly Significant Difference test (P < 0.05). The ΔntrC mutant exhibited markedly reduced virulence in both flowering and seedling assays, while complementation restored pathogenicity to wild-type levels. NC, non-inoculated control.
ppj-oa-11-2025-0166f2.jpg
Fig. 3
Attenuated virulence of the ΔntrC mutant is not solely attributable to impaired growth under nitrogen-limited conditions. (A) Photographs representing bacterial population from rice seedlings at 0 dpi and 10 dpi, determined by plating homogenized seedling extracts onto rifampicin-containing medium. Rifampicin-resistant B. glumae strains were used for selective recovery. (B) Colony-forming unit (CFU) counts from inoculated seedlings at 0 and 10 dpi. Bars represent mean ± standard deviation from three independent experiments (each with three biological replicates). Different uppercase and lowercase letters indicate statistically significant differences according to Tukey’s Honestly Significant Difference test (P < 0.05) between 0 and 10 dpi in the WT and ΔntrC mutant, respectively. There was no significant difference in bacterial populations between WT and ΔntrC at either 0 or 10 dpi. NC, non-inoculated control.
ppj-oa-11-2025-0166f3.jpg
Fig. 4
Effects of NtrC on virulence-associated traits of Burkholderia glumae BGR1. (A) Photographs representing swimming motility of wild-type (WT), ΔntrC mutant, and complemented strain (CntrC) on soft agar plates after 48 h of incubation at 37°C. (B) Bar graphs representing the quantification of swimming motility based on the diameter of the motility zone. (C) Photographs representing biofilm formation by WT, ΔntrC, and CntrC strains grown for 48 h in minimal medium (MM-Gln), visualized by crystal violet staining in 96-well polystyrene plates. (D) Bar graphs representing the quantification of biofilm biomass after solubilization of crystal violet and measurement of absorbance at 570 nm. Bars represent mean ± standard deviation from three independent experiments. Different lowercase letters above the bars indicate statistically significant differences among strains according to Tukey’s Honestly Significant Difference test (P < 0.05). The ΔntrC mutant exhibited significantly reduced motility and biofilm formation compared with WT, whereas complementation restored both phenotypes to near-WT levels.
ppj-oa-11-2025-0166f4.jpg
Fig. 5
Effects of NtrC on protease activity and toxoflavin production in Burkholderia glumae BGR1. (A) Photographs representing protease activity assays on skim milk agar plates. Clear zones surrounding the wells indicate protease secretion by the wild-type (WT), ΔntrC mutant, and complemented strain (CntrC). (B) Quantification of protease activity based on the diameter of the clearance zones. (C) Photographs representing thin-layer chromatography (TLC) analysis of toxoflavin extracted from culture supernatants of WT, ΔntrC, and CntrC strains, visualized under UV light (365 nm). (D) Quantification of toxoflavin production by measuring absorbance at 393 nm; values are expressed as Abs393/OD600 to normalize for differences in culture density among strains. Bars represent mean ± standard deviation from three independent experiments. Different lowercase letters above the bars indicate statistically significant differences among strains according to Tukey’s Honestly Significant Difference test (P < 0.05).
ppj-oa-11-2025-0166f5.jpg
Table 1
Bacterial strains and plasmids
Strain or plasmid Characteristics References
B. glumae
 BGR1 Wild-type, Rif Jeong et al., 2003
 ΔntrC BGR1 ΔntrC This study
 CntrC ΔntrC harboring pBBR1_ntrC This study
E. coli
 DH5α λpir For cloning and replication of plasmids Lab collection
 S17-1 λpir For transferring cloning plasmids to recipient cells Lab collection
Plasmids
 pK18mobsacB Allelic exchange suicide vector, sacB, Km Schäfer et al., 1994
 pBBR1MCS-2 Broad host range expression vector, Km Kovach et al., 1995
 pK18_ntrC pK18mobsacB vector cloning LR fragment of ntrC This study
 pBBR1_ntrC pBBR1MCS2 vector including ntrC gene This study
Table 2
Primers used in this study
Purpose Primer name Sequence (5′ to 3′)
Amplifying internal region of ntrC Hfq1_F AAAAGAATTCGGAGTACGCCATGAGCAACA
Amplifying internal region of ntrC Hfq1_R AAAAGGTACCGGAGCAACACGACGTACTGG
Confirming vectors and mutants Lacfuse_R GGGGATGTGCTGCAAGGCG
Confirming for mutants Hfq1_Up_F TAGTGTAGCGATTGACGGCG
Amplifying L fragment of ntrC ntrC _LF TTTGGATCCTCGGATTTTCTACCCGCTCG
Amplifying L fragment of ntrC ntrC _LR CGTGAAATCGAGCGCCTCCGGCTTCATAGGTCGGTCAG
Amplifying R fragment of ntrC ntrC _RF CTGACCGACCTATGAAGCCGGAGGCGCTCGATTTCACG
Amplifying R fragment of ntrC ntrC _RR TTTAAGCTTCCAGTGAAGCGAATCGGACA
Confirming for mutants ntrC _UP_F GACCCGAAGAACCCCGACTA
Confirming for mutants ntrC _DOWN_R CCAGAAGGCACAGACGGACC
Confirming for mutants pk18_Down_R GTGAAGCTAGCTTATCGCCAT
Amplifying ntrC to add in pBBR1MCS-2 pBBR1MCS-2_ntrC_cF TTTAAGCTTTATGAAGCCGATCTGGATAGTAGAC
Amplifying ntrC to add in pBBR1MCS-2 pBBR1MCS-2_ntrC_cR TTTGGATCCTCAAGGCTCCAGATGCAGTT

Underlined sequence in the primers indicates restriction enzyme targeted sequences. GGATCC, BamHI; AAGCTT, HindIII.

Table 3
Chemical components of trace element solution
Components Amount per L
Citric acid 50 g
ZnSO4·6H2O 50 g
Fe(NH4)2(SO4)2·6H2O 10 g
CuSO4·5H2O 2.5 g
MnSO4 0.5 g
H3BO3 0.5 g
Na2MoO4·2H2O 0.5 g
CHCl3 10 mL

References

Alford, M. A., Baghela, A., Yeung, A. T. Y., Pletzer, D. and Hancock, R. E. W. 2020. NtrBC regulates invasiveness and virulence of Pseudomonas aeruginosa during high-density infection. Front. Microbiol. 11:773.
crossref pmid pmc
Ball, A. L., Augenstein, E. D., Wienclaw, T. M., Richmond, B. C., Freestone, C. A., Lewis, J. M., Thompson, J. S., Pickett, B. E. and Berges, B. K. 2022. Characterization of Staphylococcus aureus biofilms via crystal violet binding and biochemical composition assays of isolates from hospitals, raw meat, and biofilm-associated gene mutants. Microb. Pathog. 167:105554.
crossref pmid
Chien, C. C. and Chang, Y. C. 1987. The susceptibility of rice plants at different growth stages and of 21 commercial rice varieties to Pseudomonas glumae. J. Agric Res. 36:302-310.
Dorrell, N., Guigue-Talet, P., Spencer, S., Foulonge, V., O’Callaghan, D. and Wren, B. W. 1999. Investigation into the role of the response regulator NtrC in the metabolism and virulence of Brucella suis. Microb. Pathog. 27:1-11.
pmid
Fagard, M., Launay, A., Clément, G., Courtial, J., Dellagi, A., Farjad, M., Krapp, A., Soulié, M. C. and Masclaux-Daubresse, C. 2014. Nitrogen metabolism meets phytopathology. J. Exp. Bot. 65:5643-5656.
crossref pmid
Goto, K. 1956. A new bacterial disease of rice. Ann. Phytopathol. Soc. Jpn. 21:46-47.
Goto, T., Nishiyama, K. and Ohata, K. 1987. Bacteria causing grain rot of rice. Jpn J. Phytopathol. 53:141-149 (in Japanese).
crossref
Green, M. R. and Sambrook, J. 2012. Molecular cloning: a laboratory manual. 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
Jeong, Y., Kim, J., Kim, S., Kang, Y., Nagamatsu, T. and Hwang, I. 2003. Toxoflavin produced by Burkholderia glumae causing rice grain rot is responsible for inducing bacterial wilt in many field crops. Plant Dis. 87:890-895.
crossref pmid
Jung, H., Han, G., Lee, D., Jung, H. K., Kim, Y. S., Kong, H. J., Kim, Y. O., Seo, Y. S. and Park, J. 2025. Understanding the impact of salt stress on plant pathogens through phenotypic and transcriptomic analysis. Plants (Basel) 14:97.
crossref pmid pmc
Kamimura, R., Kanematsu, H., Ogawa, A., Kogo, T., Miura, H., Kawai, R., Hirai, N., Kato, T., Yoshitake, M. and Barry, D. M. 2022. Quantitative analyses of biofilm by using crystal violet staining and optical reflection. Materials (Basel) 15:6727.
crossref pmid pmc
Kim, H. S., Park, S. J. and Lee, K. H. 2009. Role of NtrC-regulated exopolysaccharides in the biofilm formation and pathogenic interaction of Vibrio vulnificus. Mol. Microbiol. 74:436-453.
crossref pmid pmc
Kim, J., Kim, J. G., Kang, Y., Jang, J. Y., Jog, G. J., Lim, J. Y., Kim, S., Suga, H., Nagamatsu, T. and Hwang, I. 2004. Quorum sensing and the LysR-type transcriptional activator ToxR regulate toxoflavin biosynthesis and transport in Burkholderia glumae. Mol. Microbiol. 54:921-934.
crossref pmid
Kim, N., Lee, D., Lee, S. B., Lim, G. H., Kim, S. W., Kim, T. J., Park, D. S. and Seo, Y. S. 2023. Understanding Burkholderia glumae BGR1 virulence through the application of toxoflavin-degrading enzyme, TxeA. Plants (Basel) 12:3934.
crossref pmid pmc
Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M. and Peterson, K. M. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.
crossref pmid
Kurita, T. 1967. On the pathogenic bacterium of bacterial grain rot of rice. Ann Phytopathol Soc Jpn. 33:111.(in Japanese).
Lee, J., Park, J., Kim, S., Park, I. and Seo, Y. S. 2016. Differential regulation of toxoflavin production and its role in the enhanced virulence of Burkholderia gladioli. Mol. Plant Pathol. 17:65-76.
crossref pmid pmc pdf
Leigh, J. A. and Dodsworth, J. A. 2007. Nitrogen regulation in bacteria and archaea. Annu. Rev. Microbiol. 61:349-377.
crossref pmid
Li, X., Li, Y., Wang, R., Wang, Q. and Lu, L. 2019. Toxoflavin produced by Burkholderia gladioli from Lycoris aurea is a new broad-spectrum fungicide. Appl. Environ. Microbiol. 85:e00106-19.
crossref pmid pmc pdf
Liu, D., Zhao, M., Qiao, P., Li, Z., Chen, G., Guan, W., Bai, Q., Walcott, R., Yang, Y. and Zhao, T. 2023. NtrC contributes to nitrogen utilization, stress tolerance, and virulence in Acidovorax citrulli. Microorganisms 11:767.
crossref pmid pmc
López-Berges, M. S., Rispail, N., Prados-Rosales, R. C. and Di Pietro, A. 2010. A nitrogen response pathway regulates virulence functions in Fusarium oxysporum via the protein kinase TOR and the bZIP protein MeaB. Plant Cell 22:2459-2475.
crossref pmid pmc pdf
Mannaa, M., Park, I. and Seo, Y. S. 2018. Genomic features and insights into the taxonomy, virulence, and benevolence of plant-associated Burkholderia Species. Int. J. Mol. Sci. 20:121.
crossref pmid pmc
Marunga, J., Kang, Y., Goo, E. and Hwang, I. 2022. Hierarchical regulation of Burkholderia glumae type III secretion system by GluR response regulator and Lon protease. Mol. Plant Pathol. 23:1461-1471.
pmid pmc
Merrick, M. J. and Edwards, R. A. 1995. Nitrogen control in bacteria. Microbiol. Rev. 59:604-622.
crossref pmid pmc pdf
Nandakumar, R., Shahjahan, A. K. M., Yuan, X. L., Dickstein, E. R., Groth, D. E., Clark, C. A., Cartwright, R. D. and Rush, M. C. 2009. Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the Southern United States. Plant Dis. 93:896-905.
crossref pmid
Nickzad, A., Lépine, F. and Déziel, E. 2015. Quorum sensing controls swarming motility of Burkholderia glumae through regulation of rhamnolipids. PLoS One 10:e0128509.
crossref pmid pmc
North, H., McLaughlin, M., Fiebig, A. and Crosson, S. 2023. The Caulobacter NtrB-NtrC two-component system bridges nitrogen assimilation and cell development. J. Bacteriol. 205:e0018123.
crossref pmid pmc
Ortega, L. and Rojas, C. M. 2021. Bacterial panicle blight and Burkholderia glumae: from pathogen biology to disease control. Phytopathology 111:772-778.
crossref pmid
O’Toole, G. A. 2011. Microtiter dish biofilm formation assay. J. Vis. Exp. 47:2437.
Pérez-García, A. 1995. Differential expression of glutamine synthetase isoforms in tomato detached leaflets infected with Pseudomonas syringae pvtomato. MPMI 8:96-103.
crossref
Pérez-García, A., Pereira, S., Pissarra, J., García Gutiérrez, A., Cazorla, F. M., Salema, R., de Vicente, A. and Cánovas, F. M. 1998. Cytosolic localization in tomato mesophyll cells of a novel glutamine synthetase induced in response to bacterial infection or phosphinothricin treatment. Planta 206:426-434.
crossref pdf
Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G. and Pühler, A. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73.
crossref pmid
Shahjahan, A., Rush, M., Groth, D. and Clark, C. 2000. Panicle blight. Rice J. 15:26-29.
Shew, A. M., Durand-Morat, A., Nalley, L. L., Zhou, X. G., Rojas, C. and Thoma, G. 2019. Warming increases bacterial panicle blight (Burkholderia glumae) occurrences and impacts on USA rice production. PLoS One 14:e0219199.
crossref pmid pmc
Simon, R., Priefer, U. and Pühler, A. 1983. A broad host range mobilization system for in vivo genetic engineering: Transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1:784-791.
crossref pmc
Snoeijers, S. S., Pérez-García, A., Joosten, M. H. A. J.n and De Wit, P. J. G. M.n 2000. The effect of nitrogen on disease development and gene expression in bacterial and fungal plant pathogens. Eur. J. Plant Pathol. 106:493-506.
crossref pdf
Suzuki, F., Sawada, H., Azegami, K. and Tsuchiya, K. 2004. Molecular characterization of the tox operon involved in toxoflavin biosynthesis of Burkholderia glumae. J. Gen. Plan. Pathol. 70:97-107.
crossref pdf
Vestby, L. K., Grønseth, T., Simm, R. and Nesse, L. L. 2020. Bacterial biofilm and its role in the pathogenesis of disease. Antibiotics (Basel) 9:59.
crossref pmid pmc
Zhou, X. G. 2014. First report of bacterial panicle blight of rice caused by Burkholderia glumae in South Africa. Plant Dis. 98:566.
crossref pmid
Zhou-qi, C., Bo, Z., Guan-lin, X., Bin, L. and Shi-wen, H. 2016. Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Sci. 23:111-118.
crossref


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next