A Novel Recombined Potato virus Y Isolate in China

Article information

Plant Pathol J. 2017;33(4):382-392
Publication date (electronic) : 2017 August 01
doi : https://doi.org/10.5423/PPJ.OA.09.2016.0189
1College of Agricultural, Northeast Agricultural University, Harbin 150030, China
2Virus-free Seeding Research Institute of Heilongjiang Academy of Agricultural Sciences, Harbin 150086, China
3Norwegian Institute of Bieconomy Research, Aas 1432, Norway
*Co-corresponding authors. J Zhang, Phone) +86-15146006778, FAX) +86-045155190447, E-mail) Podozjh@163.com. Y Bai, Phone) +86-18604600733, FAX) +86-04525879501, E-mail) yanjubai@163.com
Handling Associate Editor: Seo, Young-Su
Received 2016 September 13; Revised 2017 May 16; Accepted 2017 May 20.

Abstract

This study reports the findings of a distinct Potato virus Y (PVY) isolate found in Northeast China. One hundred and ten samples (leaves and tubers) were collected from potato plants showing mosaic symptoms around the city of Harbin in Heilongjiang province of China. The collected tubers were planted and let to grow in a greenhouse. New potato plants generated from these tubers showed similar symptoms, except for one plant. Subsequent serological analyses revealed PVY as the causing agent of the disease. A novel PVY isolate (referred to as HLJ-C-44 in this study) was isolated from this sample showing unique mild mosaic and crisped leaf margin symptoms. The complete genome of this isolate was analyzed and determined. The results showed that HLJ-C-44 is a typical PVY isolate. Phylogenetic analysis indicated that this isolate belongs to the N-Wi strain group of PVY recombinants (PVYN-Wi) and also shared the highest overall sequence identity (nucleotide and amino acid) with other members of this strain group. However, recombination analysis of isolate HLJ-C-44 revealed a recombination pattern that differed from that of other PVYN-Wi isolates. Moreover, biological assays in four different potato cultivars and in Nicotiana tabacum also revealed a different phenotypic response than that of a typical PVYN-Wi isolate. This data, combined, suggest that HLJ-C-44 is a novel PVY recombinant with distinct biological properties.

Introduction

Potato virus Y (PVY) is by far the most widely studied and distributed potato infecting virus. It is present in all potato growing areas of the world. PVY is the type member of the genus Potyvirus, family Potyviridae (Gray et al., 2010). It causes serious diseases in potato and tobacco and brings huge economic losses (Gao et al., 2013; Hu et al., 2011; Ogawa et al., 2008). Infection of potatoes by PVY can result in a variety of symptoms ranging from mild to severe mosaic and vein necrosis, depending on the potato cultivars and virus strains. In addition, viral infection can result in a decrease in yield production of up to 80% or even more in severe cases (Glais et al., 2002; Nolte et al., 2007; Whitworth et al., 2006). PVY is a single-stranded, positive-sense RNA virus of approximately 9700 nucleotides (nt) in size, which is encapsidated within a flexuous rod shape virion. The genomic RNA contains one single open reading frame (ORF) which encodes a polyprotein of 3061 amino acids (aa) (Riechmann et al., 1992). After translation, the viral polyprotein is subsequently cleaved into nine mature peptides by the action of the viral encoded proteinase (Nichol et al., 2005). An additional viral protein is produced by a +2 reading frame shift of the P3 cistron (Chung et al., 2008).

Initially, PVY was classified into three strains groups: PVYN (necrotic), PVYC (stipple streak), and PVYO (ordinary), based on reactions observed in potato cultivars carrying the Ny and Nc genes and in the induction of venial necrosis in tobacco. PVYN isolates induce veinal necrosis in tobacco whereas PVYO and PVYC induce a hypersensitive response (HR) on Ny and Nc carrying potato cultivars, respectively (Jones, 1990). Nevertheless, other strain groups, which deviate from the three main strain groups (PVYN, PVYO, and PVYC) have been described (Jones, 1990). PVY isolates that react serologically to PVYO antibodies, but induce typical PVYN necrosis in tobacco are classified as PVYN-Wi (Beczner et al., 1984; Chrzanowska, 1991; Mcdonald and Singh, 1996a, 1996b; Ohshima et al., 2002; Singh et al., 2008). The PVYN-Wi strain group is composed of isolates which are genetic recombinants of PVYN and PVYO (Gray et al., 2010). PVYN-Wi isolates can be divided into two groups based on the recombination patters. One group contains two recombination junctions (in the P1 and HC-Pro/P3 enconding regions) and the second group, which is designated as PVYN:O in North America (Gray et al., 2010), has only one (in the HC-Pro/P3 enconding region) (Fig. 1; Karasev and Gray, 2013; Piche et al., 2004). Furthermore, PVY isolates which fall into the PVYN classification due to their ability to induce necrosis in tobacco and their positive reaction to PVYN antibodies, but are associated with the occurrence of potato tuber necrosis disease (PTNRD) are classified as PVYNTN (Beczner et al., 1984; Gray et al., 2010; Romancer et al., 1994; van den Heuvel et al., 1994). Similar to PVYN-Wi, PVYNTN can also occur as recombinants of PVYN and PVYO. Some PVYNTN isolates contain three recombination junctions (in the HC-Pro/P3, VPg encoding regions and the C-terminus of the CP) (Karasev and Gray, 2013) and other isolates contain four recombination junctions (in the P1, HC-Pro/P3, VPg encoding regions and the C-terminus of the CP) (Fig. 1; Gao et al., 2014). In 2010, Ali et al. (2010a) reported a new PVYNTN recombinant associated with PTNRD which differs from the previously described since it shares the recombination characteristics of both PVYNTN and PVYNWi (Ali et al., 2010a; Karasev and Gray, 2013). Nevertheless, non-recombinant PVYNTN isolates also exist, and have been reported in North America and Japan (Nie and Singh, 2003; Ogawa et al., 2008; Ohshima et al., 2000).

Fig. 1

Schematic representation of the recombination events within PVY isolates. Recombination events occurring at a breakpoint estimated at position 522bp of the sequence alignment for the HLJ-C-44 were identified using RDP4 analysis software.

This study reports the findings of a unique PVY isolate found during field studies in Northeast China; one of the biggest potato producing area in China. In this study, one hundred and ten samples (leaves and tubers) were collected from potato plants showing mosaic symptoms around the city of Harbin (Heilongjiang, China). The collected tubers were planted in the greenhouse and let to grow. New potato plants generated from these tubers showed similar symptoms, except for one plant. Subsequent analyses revealed PVY as the causing agent of the disease. We hence further characterized this isolate. Results show that this isolate (referred to as HLJ-C-44 in this study) is genetically and biologically distinct from previously characterized isolates, indicating that HLJ-C-44 is possibly a novel PVY recombinant.

Materials and Methods

Virus isolate, host plant assay and serology

One hundred and ten samples were collected from a field in the vicinity of Harbin city, Heilongjiang province, China. Leaves and tubers were collected from potato plants showing mosaic symptoms. Subsequently, tubers were planted in the greenhouse and let to grow. Isolate HLJ-C-44 was selected for further characterization due to its unique symptomatological characteristics (mild mosaic symptoms and crisped leaf margin) (Fig. 2A, 2B).

Fig. 2

Symptoms of isolate HLJ-C-44 and viral purification. (A) Mild mosaic and crisped leaf marginsymptoms of isolate HLJ-C-44 in potato variety KeXin 13. (B) Healthy potato leaves of potato variety KeXin 13. (C) Visualization of efficient viral purification by electron microscopy.

HLJ-C-44 was screened for the presence of common potato viruses (PVY, Potato virus X, Potato virus A, Potato virus M, Potato virus S, Potato leaf roll virus, Tobacco rattle virus, Alfalfa mosaic virus, Cucumber mosaic virus, Potato virus V, Potato virus T, Potato mop top virus, Tomato spotted wilt virus, Potato aucuba mosaic virus, Tomato black ring virus and Tobacco mosaic virus) by DAS-ELISA (Adgen, Auchincruive, Ayr, UK and Agdia, Elkhart, USA). In addition, Potato spindle tuber viroid was tested by nucleic acid spot hybridization (Fig. 3) as described by Lü et al (2009). The results showed only positive infection of PVY (Table 1). Subsequently, HLJ-C-44 was mechanically inoculated to Nicotiana tabacum and propagated.

Fig. 3

Nucleic acid spot hybridization assay for detection of PSTVd. (A, B) positive controls. (C, D) negative controls. (E, F) HLJ-C-44 samples.

Serological reactions of HLJ-C-44 to antibodies used for detection of the most common potato-infecting viruses

The serotype of HLJ-C-44 was investigated by compound direct ELISA using two PVY monoclonal antibodies, MAb2 and 1F5 (Agdia, Elkhart, USA). The assays were conducted in duplicate following the manufacturer’s instructions.

The following potato varieties were selected to further characterize HLJ-C-44: KeXin 13, KeXin 18, HeLan 15 and XingJia 2. These varieties are the main varieties cultivated in Heilongjiang province. Virus particles were purified from tobacco plant inoculated with HLJ-C-44 using a sucrose gradient and high speed centrifugation as described by Fan (2010). The viral purification was verified by electron microscopy (Fig. 2C) and diluted to the appropriate concentration (about 0.1 mg/ml). Purified virus was used for the mechanical inoculations. Young potato and tobacco seedlings were inoculated on six to eightcarborundum dusted leaves per plant. Once a systemic infection occurred, symptomatic leaves were collected and tested by PCR.

Due to its genetic similarity with PVYN-Wi, a PVYN-Wi isolate (HLJ-BDH-2, genebank accession number KX032614) from our genebank collection was selected for comparison. This isolate was purified, inoculated to the same potato varieties (KeXin 13, KeXin 18, HeLan 15 and XingJia 2) and tested as described above.

RNA extraction and genome sequencing

Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufactures instructions. After extraction, the RNA was verified by gel electrophoresis and quantified by spectrophotometry. cDNA was synthesized from total RNA using the ImProm-II Reverse Transcriptase (Promega, Madison, WI, USA) in accordance with the manual. The synthesized cDNA was stored at −20°C until use.

The 5′ and 3′terminus of the PVY genome were obtained using 5′and 3′ RACE kit (Roche, Mannheim, Germany) and the assay was conducted in duplicate following the manufacturer’s instructions. The complete PVY genome was amplified using PCR and three primer pairs (Table 2). Three overlapping fragments were amplified using PrimeSTAR Max DNA Polymerase (Takara, Dalian, China) following the manufacturer’s instructions. The annealing temperature for the three primer pairs is the following: PVY4F-PVY3980 is 50°C, PVY2F-PVY2R is 57°C and PVY3F-PVY3R is 53°C.

Primer used to amplify and clone PVY isolate HLJ-C-44

Amplified fragments were gel purified, cloned into pEASY-T5 (TransGen, Beijing, China) and propagated in Trans 1 cells (TransGen). For every PCR product, 5 clones were selected, purified and sequenced in the Beijing Genomics Institute Ltd for sequencing (BGI). The full length PVY sequence was assembled using DNAMAN (version 8.0; Lynnon Biosoft, San Ramon, USA) phylogenetic analysis software.

Phylogeny, sequence comparison and recombination analysis

Phylogenetic analysis, nucleotide and amino acid comparisons were carried out using the Bio Edit software and the online Blast software at NCBI (http://www.blast.ncbi.nlm.nih.gov/). The phylogenetic tree was generated using 32 isolates, from which the complete polyprotein-encoding region (9186 nt) was available in the NCBI GenBank. Isolates were to chosen to cover a representative number of isolates per strain group. The 5′NTR and 3′NTR regions were not included in the analysis. The ClustalX software was subsequently used to conduct multiple sequence alignments. The MrModeltest software was used for the nucleotide substitution analysis using the GTR+G+I in Akaike Information Criterion (AIC) standard model. This data was subsequently fed into the MEGA 6.0 software to generate a Maximum likelihood (ML) tree with a 1000 bootstrap confidence. Nucleotide and amino acid sequence comparison was carried out with the 15 PVY isolates (out of the 32 used for the phylogenetic tree) from which the complete genome (including the 5′ and 3′ NTR) were available (Table 3, 4). These isolates also represented all strain groups mentioned in this study. Pairwise comparisons were carried out using Blast online service.

Non-coding and coding regions of HLJ-C-44 nucleotide sequence identity with 15 representative PVY isolates

Percentages of amino acid sequence identity of HLJ-C-44 with 15 representative PVY isolates

Recombination analysis was carried out using RDP, GENECONV, BOOTSCAN, MAXCHI and SISCAN methods implemented in RDP4 (version 4.71) pack (University of Cape Town, Cape Town, South Africa) (Martin and Rybicki, 2000). The complete sequence of non-recombinant PVY isolates was obtained from the GenBank and was used for recombination analysis (Table 5). The analyses were done using default settings and a Bonferroni- corrected P-value cutoff of 0.01. Only recombination breakpoints detected by a minimum of five methods within the program were considered as significant data.

The complete sequence of non-recombinant PVY isolates obtained from the GenBank used for recombination analysis

Multiplex RT-PCR for determining HLJ-C-44

In order to further verify the strain of HLJ-C-44 isolates, the multiplex RT-PCR system established by Ali et al. (2010b) was adopted. Through the single or mixed infection of PVY samples by multi-sets of specific primers, this system amplifies RT-PCR. The major PVY strain was determined through the band size and the different band combinations produced by gel electrophoresis of the PCR products, including PVYO, PVYN and PVYN-Wi.

Results

Screening for other common potato viruses, viral purification and symptoms expression of isolate HLJ-C-44

DAS-ELISA and NASH results showed that within the viruses and viroid tested for, only PVY was present (Table 1, Fig. 3). In addition, sucrose gradient and high speed centrifugation viral purification resulted in purification of typical PVY flexuous rod shape virions (Fig. 2C). Moreover, inoculation of these purified particles to potato variety KeXin 13, resulted in mosaic and leaf crisping symptoms (Fig. 2A). These symptoms were identical to the ones observed in the potato plant which the PVY isolate was purified.

Genome analysis

The full-length sequence of HLJ-C-44 was amplified and sequenced using a primer-walking strategy and standard cloning techniques. The length of isolate HLJ-C-44 was found to be 9710 nt (excluding poly A tail). The coding region is composed of 9186 nt encoding a polyprotein of 3061 aa. The length of 5′ and 3′ NTR are 185 and 339 nt, respectively. Within the polyprotein, nine putative protein cleavages were identified. The cleavage sites (following the N-terminus to Carboxyl-terminus orientation) were predicted to be: Q/G, G/G, Q/R, Q/S, Q/A, Q/G, E/A, Q/A and Q/G. Furthermore, the recently discovered PIPO protein (Chung et al., 2008) produced by a +2 phase reading frame shift was found in the P3 cistron. The genome of isolate HLJ-C-44 has been submitted to the GenBank database and given the accession number KU569326.

Pairwise nucleotide sequence identity analysis was carried out with the coding regions of 15 PVY isolates representing all strain groups of this study from which the complete sequence (including NTRs) is available from the NCBI (Table 3). HLJ-C-44 shared the highest nucleotide similarity (over 96%) with the PVYN-Wi members SGS-AG and Mb112; and the lowest (under 86%) with isolates RRA-1 (PVYNTN), N605 (PVYN) and Mont (PVYN). At the amino acid level, HLJ-C-44 also shared the highest similarity (over 97%) with SGS-AG and Mb112 and the lowest (93%) with RRA-1, N605, Mont and Adgen (PVYC) (Table 4).

All the protein-encoding regions of HLJ-C-44 shared more than 96% (nt) and 97% (aa) sequence similarities with PVYN-Wi SGS-AG and Mb112, except for the P1 (Table 3 and Table 4). The P1 of HLJ-C-44 shared 91% (nt) and 92% (aa) sequence similarity with SGS-AG; and only 81% (nt) and 82% (aa) sequence similarity with Mb112. Computer assisted sequence alignment revealed that the difference localizes to nucleotides 310–522 in SGS-AG and was even longer in the P1 of Mb112 (nucleotides 1–522). Interestingly, from all the isolates included in this study, the P1 of HLJ-C-44 shared the highest sequence identity [97% (nt) and 98% (aa)] with a PVYNTN isolate (SYR-III-L4). The P1 similarities with other isolates ranged from 80%–91% (nt) and 76%–92% (aa) level.

Phylogenetic and recombination analysis

The phylogenetic analysis indicated that 32 different PVY isolates can be grouped into four main clusters, N/NTN, N-Wi, O and C and are supported by bootstrap values over 74%. Individual isolates incorporated into these four main clusters are supported by reliable bootstrap values (over 51%) and agree with their previous strain grouping (Wang et al., 2013; Gao et al., 2015). Isolate HLJ-C-44 was grouped within the N-Wi cluster with a bootstrap confidence value of 86% (Fig. 4).

Fig. 4

Evolutionary relationship of HLJ-C-44 with selected PVY strains. The following PVY isolates, with their respective Genbank ID number in parenthesis, were used: NTN/N: EF026075, JQ924287, JF928460, M95491, AJ890744, AJ585198, AY884984, AY166867, AJ585197, AY884983, X97895, AB270705, GQ200836, AJ889866, AJ890342, AB461452, AB461451, AB461453 and AB461454; N-Wi: AY745491, AY745492, EF026076, DQ008213, HQ912863, AJ890350 and JQ924288; O: EF026074, AJ585195 and U09509; C: AJ890348, AF237963 and DQ309028; Out group: NC_002509.

Previous studies indicate that PVYN-Wi strain group members are recombinants between PVYN and PVYO (Glais et al., 2002). RDP4 analysis revealed one recombination event consisting of spliced fragments from two non-recombinant PVY isolates, Mont (AY884983) and SASA-110 (AJ585195). The recombinant breakpoint was detected by five methods implemented in RDP4 [RDP (4.496×10−179), GENECONV (6.579×10−171), Boot Scan (7.074×10−174), Max Chi (2.031×10−41), and SiScan (6.134×10−43)] which confirmed the recombination event. The results revealed two recombination junctions within the HLJ-C-44 genome, at nucleotide 522 and 2220 (Fig. 1). Recombination analysis was also carried out with two other PVYN-Wi isolates (SGS-AG and Mb112). Isolate SGS-AG also contained two recombination junctions. It shared the same end recombination junction as HLJ-C-44 (nucleotide 2220) but differed in the first recombination junction. The first recombination junction of SGS-AG was located in nucleotide 310 rather than 522. Isolate Mb112 showed only one recombination junction at nucleotide 2220 (the same as HLJ-C-44; Fig. 1).

Physiological symptoms

Greenhouse experiments showed that HLJ-C-44 was unique since it showed mosaic symptoms and crisped leaf margins in leaves, but was lacking systemic veinal necrosis. DAS-ELISA and nucleic acid spot hybridization assays revealed only the presence of PVY.

Mechanical inoculation of the purified virus isolate HLJ-C-44 to four potato varieties (KeXin 13, KeXin 18, HeLan 15 and XingJia 2) resulted in a range of symptoms (Table 6). In addition, a PVYN-Wi isolate was also inoculated to the 4 potato varieties. PVYN-Wi was selected for the biological assay comparison since it was the most closely genetically related PVY [97% (nt), 98% (aa) similarity over the complete coding region]. HLJ-C-44 caused similar symptoms (systemic mild mosaic) in varieties KeXin 18, HeLan 15 and XingJia 2. However, inoculation of HLJ-C-44 to variety KeXin 13 resulted in a more pronounced systemic mosaic accompanied with leaf crisping. On the other hand, PVYN-Wi differed from HLJ-C-44 in that it only induced a mild mosaic in KeXin 13 but induced leaf deformation and systemic mosaic in XingJia 2. PVYN-Wi induced similar symptoms in Kexin 18 and HeLan 15 as HLJ-C-44. No symptoms were observed in tubers harvested from HLJ-C-44 and PVYN-Wi infected plants (observation of tubers after storage for 1 month) (Fig. 5). HLJ-C-44 systemically infected tobacco plants generating only mild mosaic symptoms, whereas infection of tobacco plants with PVYN-Wi resulted in veinal necrosis and mosaic.

Responsea of 4 potato cultivars to HLJ-C-44 and HLJ-BDH-2b infection.

Fig. 5

No Symptoms of potato tubers after infected with HLJ-C-44 and PVYN-Wi. Observation of tubers after storage for 1 month, no symptoms in the tubers. A, D, G, J: infected with HLJ-C-44, A: KeXin 13, D: KeXin 18, G: HeLan 15, J: XingJia 2; B, E, H, K: infected with PVYN-Wi, B: KeXin 13, E: KeXin 18, H: HeLan 15, K: XingJia 2; C, F, I, L: Negative control, C: KeXin 13, F: KeXin 18, I: HeLan 15, J: XingJia 2.

Determination of results of the HLJ-C-44 multiplex RT-PCR

HLJ-C-44 isolates were amplified into two specific fragments through the multiplex RT-PCR at approximately 800 and 400 bp, respectively (Fig. 6). These were of concordant band size with the two specific 853 and 441 bp of the PVYN-Wi strain in the determination method reported by Ali et al (2010b). This result further confirms that the HLJ-C-44 isolates are of the PVYN-Wi strain.

Fig. 6

HLJ-C-44 and PVYN-Wi isolate differences. Note: M: Marker DNA (D2000); 1: Multiplex RT-PCR products of PVY HLJ-C-44 isolate; 2 Line2: Multiplex RT-PCR products of PVY HLJ-BDH-2 isolate.

Discussion

In this study, we characterized, at a biological and molecular level, a unique PVY isolate (HLJ-C-44) found infecting potatoes in Northeast China. Multiple sequence aligments and phylogenetic analysis indicate that this isolate (HLJ-C-44) clusters within the PVYN-Wi strain group (Fig. 4) and also shares the highest amino acid and nucleotide sequence similarity with members of the PVYN-Wi strain group, supporting its phylogenetic clustering.

Symptoms inducing between HLJ-C-44 and a PVYN-Wi isolate in some potatoes varieties and in N. tabacum were different, indicating that these isolates do not have identical biological properties. Furthermore, recombination analysis revealed that HLJ-C-44 has different recombination patters than those of other members of the PVYN-Wi strain group (SGS-AG and Mb112). Many studies show that changes in the amino acid sequence of viral encoded proteins can result in different symptoms. For example, specific point mutations within the 6K2 protein of Potato virus V have an impact on the symptoms generated in two Nicotiana species (N. tabacum and N. benthamiana). This difference in symptom expression was not correlated with different viral titers, but rather due to specific host plant interactions (Spetz and Valkonen, 2004). Furthermore, the P3-6K1 region of Plum pox virus is involved in the severity of chlorotic mottle symptoms in N. clevelandii (Riechmann et al., 1995) as well as in the ability to induce different symptoms in Pisum sativum (Sáenz et al., 2000). Thus, we can speculate that the biological difference observed in our study is due to the difference between P1 protein of HLJ-C-44 and other PVYN-Wi isolates, resulting from a recombination event. Indeed, it has been suggested that recombination events that occurred in one host may enable some recombinants to infect new hosts (Ohshima et al., 2002). However, to fully attribute this difference in symptom inducing to the P1 protein, construction of an infectious HLJ-C-44 cDNA clone, followed by mutation and replacement analysis is required. Nevertheless, the data in this study show that isolate HJL-C-44 is indeed a new recombinant that belongs to the PVYN-Wi strain group. Whether this isolate is just a sporadic case or widely distributed in China remains to be determined.

PVY is by far the most widely studies potato-infecting virus. Many studies on the molecular properties are available. In our study we have included 32 PVY isolates from which the complete coding region is available for the phylogenetic analysis, and the 15 most genetically distinct PVY isolates for sequence comparison. Our results confirm that PVY isolates group in four main clusters (N/NTN, N-Wi, O and C). However, recombination analysis shows that most of the isolates that group within the N/NTN and N-Wi cluster are not a homogenous genetic line, but rather composed of recombinants. With the current advances in meta-sequencing and decreasing sequencing prices, a much larger number of sequences are expected. It can also be expected that more PVY isolates of recombinant features would be discovered.

References

Ali MC, Maoka T, Natsuaki T, Natsuaki KT. 2010a;PVYNTN-NW, a novel recombinant strain of Potato virus Y predominating in potato fields in Syria. Plant Pathol 59:31–41. 10.1111/j.1365-3059.2009.02174.x.
Ali MC, Maoka T, Natsuaki KT, Natsuaki T. 2010b;The simultaneous differentiation of Potato virus Y strains including the newly described strain PVY(NTN-NW) by multiplex PCR assay. J Virol Methods 165:15–20. 10.1016/j.jviromet.2009.12.010.
Beczner L, Horváth J, Romhányi I, Förster H. 1984;Etiology of tuber ringspot disease in potato. Potato Res 27:339–352. 10.1007/BF02357646.
Chrzanowska M. 1991;New isolates of the necrotic strain of Potato virus Y (PVYN) found recently in Poland. Potato Res 34:179–182. 10.1007/BF02358039.
Chung BY, Miller WA, Atkins JF, Firth AE. 2008;An overlapping essential gene in the Potyviridae. Proc Natl Acad Sci USA 105:5897–5902. 10.1073/pnas.0800468105. 18408156. 2311343.
Fan G. 2010;Potato virus M purification method and its antiserum preparation. Acta Phytophylacica Sin 12:44.
Gao F, Chang F, Shen J, Shi F, Xie L, Zhan J. 2014;Complete genome analysis of a novel recombinant isolate of Potato virus Y from China. Arch Virol 159:3439–3442. 10.1007/s00705-014-2184-2. 25091741.
Gao FL, Chang F, Shen JG, Xie LH, Zhan JS. 2015;Complete genome analysis of a PVYNTN-NW recombinant isolate from Yulin of China. Sci Agric Sinica 48:270–279.
Gao FL, Shen JG, Shi FY, Fang ZG, Xie LH, Zhan JS. 2013;Detection and molecular variation of Potato virus Y CP gene in China. Sci Agric Sinica 46:3125–3133.
Glais L, Tribodet M, Kerlan C. 2002;Genomic variability in Potato potyvirus Y (PVY): evidence that PVY(N)W and PVY(NTN) variants are single to multiple recombinants between PVY(O) and PVY(N) isolates. Arch Virol 147:363–378. 10.1007/s705-002-8325-0. 11890528.
Gray S, Boer SD, Lorenzen J, Karasev A, Whitworth J, Nolte P, Singh R, Boucher A, Xu H. 2010;Potato virus Y: an evolving concern for potato crops in the United States and Canada. Plant Dis 94:1384–1397. 10.1094/PDIS-02-10-0124.
Hu X, Nie X, He C, Xiong X. 2011;Differential pathogenicity of two different recombinant PVY(NTN) isolates in Physalis floridana is likely determined by the coat protein gene. Virol J 8:207. 10.1186/1743-422X-8-207. 21548970. 3112444.
Jones RAC. 1990;Strain group specific and virus specific hypersensitive reactions to infection with potyviruses in potato cultivars. Ann Appl Biol 117:93–105. 10.1111/j.1744-7348.1990.tb04198.x.
Karasev AV, Gray SM. 2013;Continuous and emerging challenges of Potato virus Y in potato. Annu Rev Phytopathol 51:571–586. 10.1146/annurev-phyto-082712-102332. 23915135.
Lü DQ, Qiu CL, Wang SP, Yong LI, Gao YF. 2009;Development of cDNA dimeric probes and its application in diagnosis of potato spindle tuber viroid. Acta Horticulturae Sinica 36:1538–1544.
Martin D, Rybicki E. 2000;RDP: detection of recombination amongst aligned sequences. Bioinformatics 16:562–563. 10.1093/bioinformatics/16.6.562. 10980155.
Mcdonald JG, Singh RP. 1996a;Host range, symptomology, and serology of isolates of Potato virus Y (PVY) that share properties with both the PVYN and PVYO strain groups. Am Potato J 73:309–315. 10.1007/BF02855210.
Mcdonald JG, Singh RP. 1996b;Response of potato cultivars to North American isolates of PVYNTN. Am Potato J 73:317–323. 10.1007/BF02855212.
Nichol ST, Beaty BJ, Elliott RM, Goldbach R, Plyusnin A, Schmaljohn CS, Tesh RB. 2005. Virus taxonomy: Classification and nomenclature of viruses. 8th Report of the International Committee on Taxonomy of Viruses In : Fauquet M, Mayo MA, Maniloff J, Desselberger U, Ball LA, eds. p. 695–716. Elsevier-Academic Press. Oxford, UK:
Nie X, Singh RP. 2003;Evolution of North American PVY(NTN) strain Tu 660 from local PVY(N) by mutation rather than recombination. Virus Genes 26:39–47. 10.1023/A:1022326021195. 12680692.
Nolte P, Whitworth JL, Thornton MK, Mcintosh CS. 2007;Effect of seedborne Potato virus Y on performance of Russet Burbank, Russet Norkotah, and Shepody potato. Plant Dis 88:248–252. 10.1094/PDIS.2004.88.3.248.
Ogawa T, Tomitaka Y, Nakagawa A, Ohshima K. 2008;Genetic structure of a population of Potato virus Y inducing potato tuber necrotic ringspot disease in Japan; comparison with North American and European populations. Virus Res 131:199–212. 10.1016/j.virusres.2007.09.010.
Ohshima K, Sako K, Hiraishi C, Nakagawa A, Matsuo K, Ogawa T, Shikata E, Sako N. 2000;Potato tuber necrotic ringspot disease occurring in Japan: its association with Potato virus Y necrotic strain. Plant Dis 84:1109–1115. 10.1094/PDIS.2000.84.10.1109.
Ohshima K, Yamaguchi Y, Hirota R, Hamamoto T, Tomimura K, Tan Z, Sano T, Azuhata F, Walsh JW, Fletcher J, Chen J, Gera A, Gibbs A. 2002;Molecular evolution of Turnip mosaic virus: evidence of host adaptation, genetic recombination and geographical spread. J Gen Virol 83:1511–1521. 10.1099/0022-1317-83-6-1511. 12029167.
Piche LM, Singh RP, Nie X, Gudmestad NC. 2004;diversity among Potato virus Y isolates obtained from potatoes grown in the United States. Phytopathology 94:1368–1375. 10.1094/PHYTO.2004.94.12.1368.
Riechmann JL, Laín S, García JA. 1992;Highlights and prospects of potyvirus molecular biology. J Gen Virol 73:1–16. 10.1099/0022-1317-73-1-1. 1730931.
Riechmann JL, Cervera MT, García JA. 1995;Processing of the plum pox virus polyprotein at the P3-6K1 junction is not required for virus viability. J Gen Virol 76:951–956. 10.1099/0022-1317-76-4-951. 9049341.
Romancer ML, Kerlan C, Nedellec M. 1994;Biological characterisation of various geographical isolates of Potato virus Y inducing superficial necrosis on potato tubers. Plant Pathol 43:138–144. 10.1111/j.1365-3059.1994.tb00563.x.
Sáenz P, Cervera MT, Dallot S, Quiot L, Quiot JB, Riechmann JL, García JA. 2000;Identification of a pathogenicity determinant of Plum pox virus in the sequence encoding the C-terminal region of protein 3+6K(1). J Gen Virol 81:557–566. 10.1099/0022-1317-81-3-557.
Singh RP, Valkonen JP, Gray SM, Boonham N, Jones RA, Kerlan C, Schubert J. 2008;Discussion paper: The naming of Potato virus Y strains infecting potato. Arch Virol 153:1–13. 10.1007/s00705-007-1059-1.
Spetz C, Valkonen JP. 2004;Potyviral 6K2 protein long-distance movement and symptom-induction functions are independent and host-specific. Mol Plant-Microbe Interact 17:502–510. 10.1094/MPMI.2004.17.5.502. 15141954.
van den Heuvel JFJM, van der Vlugt RAA, Verbeek M, de Haan PT, Huttinga H. 1994;Characteristics of a resistance-breaking isolate of Potato virus Y causing potato tuber necrotic ringspot disease. Eur J Plant Pathol 100:347–356. 10.1007/BF01876445.
Wang F, Gao Z-l, An M-n, Zhou B-g, Wu Y-h. 2013;Sequencing and phylogenetic analysis of Potato virus Y liaoning isolate in China. J Integr Agric 12:1195–1200. 10.1016/S2095-3119(13)60442-6.
Whitworth JL, Nolte P, Mcintosh C, Davidson R. 2006;Effect of Potato virus Y on yield of three potato cultivars grown under different nitrogen levels. Plant Dis 90:73–76. 10.1094/PD-90-0073.
Zhang S, Yang J, Wang F, Qian Y, Shen L, Wang Y. 2011;Sequencing and analysis of PVYN strain in tobacco from Guizhou province. Chinese Tobacco Science 32:47–51.

Article information Continued

Fig. 1

Schematic representation of the recombination events within PVY isolates. Recombination events occurring at a breakpoint estimated at position 522bp of the sequence alignment for the HLJ-C-44 were identified using RDP4 analysis software.

Fig. 2

Symptoms of isolate HLJ-C-44 and viral purification. (A) Mild mosaic and crisped leaf marginsymptoms of isolate HLJ-C-44 in potato variety KeXin 13. (B) Healthy potato leaves of potato variety KeXin 13. (C) Visualization of efficient viral purification by electron microscopy.

Fig. 3

Nucleic acid spot hybridization assay for detection of PSTVd. (A, B) positive controls. (C, D) negative controls. (E, F) HLJ-C-44 samples.

Fig. 4

Evolutionary relationship of HLJ-C-44 with selected PVY strains. The following PVY isolates, with their respective Genbank ID number in parenthesis, were used: NTN/N: EF026075, JQ924287, JF928460, M95491, AJ890744, AJ585198, AY884984, AY166867, AJ585197, AY884983, X97895, AB270705, GQ200836, AJ889866, AJ890342, AB461452, AB461451, AB461453 and AB461454; N-Wi: AY745491, AY745492, EF026076, DQ008213, HQ912863, AJ890350 and JQ924288; O: EF026074, AJ585195 and U09509; C: AJ890348, AF237963 and DQ309028; Out group: NC_002509.

Fig. 5

No Symptoms of potato tubers after infected with HLJ-C-44 and PVYN-Wi. Observation of tubers after storage for 1 month, no symptoms in the tubers. A, D, G, J: infected with HLJ-C-44, A: KeXin 13, D: KeXin 18, G: HeLan 15, J: XingJia 2; B, E, H, K: infected with PVYN-Wi, B: KeXin 13, E: KeXin 18, H: HeLan 15, K: XingJia 2; C, F, I, L: Negative control, C: KeXin 13, F: KeXin 18, I: HeLan 15, J: XingJia 2.

Fig. 6

HLJ-C-44 and PVYN-Wi isolate differences. Note: M: Marker DNA (D2000); 1: Multiplex RT-PCR products of PVY HLJ-C-44 isolate; 2 Line2: Multiplex RT-PCR products of PVY HLJ-BDH-2 isolate.

Table 1

Serological reactions of HLJ-C-44 to antibodies used for detection of the most common potato-infecting viruses

Antibody1  Reaction to HLJ-C-442
PVY-MAb 2 +
PVY-1F 5
PVX
PVA
PVS
PVM
PLRV
TRV
AMV
CMV
PVV
PVT
PMTV
TSWV
PAMV
TBRV
TMV
1

Commercially available antibodies (Adgia) were used.

2

(+) Positive reaction, (−) negative reaction. The data presented corresponds to two independent experiments. Absorbance values which were twice the value of the negative control were deemed positive. Positive and negative control were included for each antibody.

Table 2

Primer used to amplify and clone PVY isolate HLJ-C-44

Primera Sequence 5′-3′b Amplicon(bp) Reference
PVY 4F AATTAAAACAACTCAATACAAC 3982bp This study
PVY 3980R ACTAGAAAGTCTAGGTGCTC
PVY2F GGA AGA ATATGATGTGCGRCA 4130bp Zhang S 2011 (Zhang et al., 2011)
PVY2R TGAATGTCCTYGTCTTATTTGC
PVY3F ATGCCRAARGAYTTCCCTGT 3163bp Zhang S 2011 (Zhang et al., 2011)
PVY3R GTCTCCTGATTGAAGTTTACAGYCACT
a

Primer orientation is the denoted by F (forward) and R (reverse).

b

R=A and G, Y=C and T.

Table 3

Non-coding and coding regions of HLJ-C-44 nucleotide sequence identity with 15 representative PVY isolates

Isolate GenBank ID number Whole coding regions (%) Non-coding regions (%) Coding regions (%)


5′NTR 3′NTR P1 HC-Pro P3 6K1 CI 6K2 VPg NIa NIb CP PIPO
HLJ-C-44 KU569326 100 100 100 100 100 100 100 100 100 100 100 100 100 100
RRA-1 (PVYNTN) AY884984 85 88 83 80 93 86 84 83 79 84 81 84 90 85
N605 (PVYN) X97895 86 85 86 82 99 85 82 83 81 85 81 84 89 85
SYR-II-2-8 (PVYNTN) AB461451 93 96 98 92 99 97 99 97 98 88 81 84 97 99
HN2 (PVYNTN) GQ200836 92 85 85 82 99 96 98 97 98 88 81 84 98 98
SYR-III-L4 (PVYNTN) AB461453 94 95 98 97 99 97 99 97 98 87 81 85 98 99
Mb112 (PVYN-Wi) AY745491 96 85 98 82 99 97 99 97 99 97 96 97 98 99
SGS-AG (PVYN-Wi) JQ924288 97 94 97 91 99 97 99 97 98 97 96 97 97 99
Oz (PVYO) EF026074 91 94 97 89 82 98 97 97 98 97 97 97 98 99
Adgen (PVYC) AJ890348 88 88 91 80 84 92 90 89 91 92 87 90 93 90
PB312 (PVYNTN) EF026075 92 85 98 82 99 97 99 97 98 87 81 84 91 99
b-34/1 (PVYNTN) AJ890342 92 96 98 92 99 97 99 97 97 88 81 84 91 99
Mont (PVYN) AY884983 86 86 86 83 99 98 83 84 84 85 82 84 89 86
SASA-110 (PVYO) AJ585195 95 95 98 89 82 85 99 98 97 99 98 98 98 99
PVY-O (PVYO) U09509 94 96 98 88 82 84 97 97 97 96 96 97 97 99
SCRI-N (PVYN) AJ585297 87 79 85 82 99 97 84 84 83 85 81 88 90 85

Table 4

Percentages of amino acid sequence identity of HLJ-C-44 with 15 representative PVY isolates

Isolate GenBank ID number Whole Coding regions (%) Non-coding regions (%) Amino acid sequence identity (%)


5′NTR 3′NTR P1 HC-Pro P3 6K1 CI 6K2 VPg NIa NIb CP PIPO
HLJ-C-44 KU569326 100 - - 100 100 100 100 100 100 100 100 100 100 100
RRA-1 (PVYNTN) AY884984 93 - - 79 97 91 87 95 88 92 92 95 93 75
N605 (PVYN) X97895 93 - - 81 99 91 85 95 88 94 93 95 93 73
SYR-II-2-8 (PVYNTN) AB461451 97 - - 92 99 98 100 99 96 94 92 95 97 97
HN2 (PVYNTN) GQ200836 96 - - 81 99 97 98 99 96 94 93 95 98 96
SYR-III-L4 (PVYNTN) AB461453 97 - - 98 99 98 100 99 96 94 92 95 97 96
Mb112 (PVYN-Wi) AY745491 97 - - 81 99 99 100 99 98 99 98 99 99 97
SGS-AG (PVYN-Wi) JQ924288 98 - - 92 99 99 100 99 98 98 98 99 97 97
Oz (PVYO) EF026074 97 - - 89 91 99 96 99 98 98 98 99 98 96
Adgen (PVYC) AJ890348 93 - - 76 92 96 96 97 90 95 93 97 94 80
PB312 (PVYNTN) EF026075 95 - - 81 99 98 100 99 98 94 92 95 94 97
b-34/1 (PVYNTN) AJ890342 96 - - 92 99 98 100 99 96 94 91 95 94 97
Mont (PVYN) AY884983 94 - - 82 99 91 87 95 88 94 92 95 94 75
SASA-110 (PVYO) AJ585195 96 - - 87 90 98 100 99 98 98 97 99 98 99
PVY-O (PVYO) U09509 96 - - 87 90 99 98 98 96 97 97 98 96 97
SCRI-N (PVYN) AJ585297 93 - - 80 99 91 87 95 87 94 92 96 94 75

Table 5

The complete sequence of non-recombinant PVY isolates obtained from the GenBank used for recombination analysis

Isolate name  Strain   Accession no. 
SASA-110 O AJ585195
PVY-O O U09509
Nnp C AF237963
NC57 C DQ309028
C-Agden C AJ890348
SCRI-N N AJ585197
RRA-1 N AY884984
N-Jg N AY166867
Oz O EF026074
N605 N X97895
Mont N AY884983

Table 6

Responsea of 4 potato cultivars to HLJ-C-44 and HLJ-BDH-2b infection.

 Potato cultivars  Isolate

HLJ-C-44 PVYN-Wi (HLJ-BDH-2)


 Response of leaves   Response of leaves 
KeXin 13 M, LMC M
KeXin 18 M M
HeLan 15 M M
XingJia 2 M M, LD
a

Symptoms: Mosaic (M), Leaf margin crisping (LMC), leaf deformation (LD), symptomless(−).

b

Isolate HLJ-BDH-2 belong to the PVYN-Wi strain group.