Plant Pathol J > Volume 34(3); 2018 > Article
Lee, Kil, Kwak, Kim, Seo, Lee, and Choi: Phylogenetic Characterization of Tomato chlorosis virus Population in Korea: Evidence of Reassortment between Isolates from Different Origins

Abstract

Tomato chlorosis virus (ToCV) is a whitefly-transmitted and phloem-limited crinivirus. In 2013, severe interveinal chlorosis and bronzing on tomato leaves, known symptoms of ToCV infection, were observed in greenhouses in Korea. To identify ToCV infection in symptomatic tomato plants, RT-PCR with ToCV-specific primers was performed on leaf samples collected from 11 tomato cultivating areas where ToCV-like symptoms were observed in 2013 and 2014. About half of samples (45.18%) were confirmed as ToCV-infected, and the complete genome of 10 different isolates were characterized. This is the first report of ToCV occurring in Korea. The phylogenetic relationship and genetic variation among ToCV isolates from Korea and other countries were also analysed. When RNA1 and RNA2 are analysed separately, ToCV isolates were clustered into three groups in phylogenetic trees, and ToCV Korean isolates were confirmed to belong to two groups, which were geographically separated. These results suggested that Korean ToCV isolates originated from two independent origins. However, the RNA1 and RNA2 sequences of the Yeonggwang isolate were confirmed to belong to different groups, which indicated that ToCV RNA1 and RNA2 originated from two different origins and were reassorted in Yeonggwang, which is the intermediate point of two geographically separated groups.

Introduction

Tomato chlorosis disease is one of the most devastating diseases in tomato crop production (Hanssen et al., 2010). The chlorotic leaf symptom of tomatoes was observed in Florida in 1989, and the virus responsible was first named Tomato chlorosis virus (ToCV) in the USA (Wisler et al., 1998b). Subsequently, this virus has been distributed to many parts of the world including European, American, African and Asian countries (Abou-Jawdah et al., 2006; Accotto et al., 2001; Alvarez-Ruiz et al., 2007; Arruabarrena et al., 2015; Barbosa et al., 2008; Bese et al., 2011; Castro et al., 2009; Çevik and Erkıß, 2008; Dalmon et al., 2005; Dovas et al., 2002; Fiallo-Olivé et al., 2011; Hirota et al., 2010; Jacquemond et al., 2009; Lett et al., 2009; Louro et al., 2000; Segev et al., 2004; Sundaraj et al., 2011; Wintermantel et al., 2001; Wintermantel and Wisler, 2006; Zhao et al., 2013a). In northeast Asia, ToCV occurrence was originally reported in China, Taiwan and Japan (Hirota et al., 2010; Tsai et al., 2004; Zhao et al., 2013b), but was not reported in Korea until 2013. ToCV is a species of the genus Crinivirus that belongs to the family Closteroviridae with flexuous filamentous particles of approximately 800 to 850 nm in length (Liu et al., 2000; Wisler et al., 1998b). ToCV is usually phloem-limited and is transmitted by whiteflies (Bemisia and Trialeuroides spp.) in a semi-persistent manner (Karasev, 2000; Wisler et al., 1998a). Mechanical inoculation and seed transmission have not been demonstrated. The genome consist of two segments of linear, positive-sense and single-stranded RNA, which are separately encapsidated (Wisler et al., 1998b; Wintermantel et al., 2005; Zhao et al., 2014). The size of ToCV RNAs 1 and 2 is 8595nt and 8247nt, respectively. RNA1 contains four open reading frames (ORFs), which encode proteins for replication. RNA2 codes nine ORFs that express proteins involved in viral encapsidation, movement and vector transmission (Wintermantel et al., 2005).
In tomato, ToCV causes interveinal yellowing that can be observed first on lower leaves and subsequent development of leaf thickening, bronzing and necrotic flecks on the older leaves (Wisler et al., 1998b; Wintermantel et al., 2005). Theses typical patterns gradually proceed toward the growing point. Although no obvious fruit symptoms have been observed, crop yield can be significantly reduced due to the loss of photosynthetic area (Wintermantel et al., 2005). Symptoms caused by ToCV are easily confused with those caused by physiological or nutritional deficiency and are very similar to those of other whitefly-transmitted viruses such as Tomato infectious chlorosis virus (TICV) (Wisler et al., 1998b). So, infection of tomato plants with these viruses is difficult to diagnose based on symptoms. In addition to tomatoes, potato (Solanum tuberosum), sweet pepper (Capsicum annuum) and zinnia (Zinnia elegans) are known ToCV hosts (Barbosa et al., 2010; Fortes and Navas-Castillo, 2012; Lozano et al., 2004; Tsai et al., 2004; Vargas et al., 2011). In total, about 36 species of plants have also been reported as ToCV hosts (Alvarez-Ruiz et al., 2007; Barbosa et al., 2010; Font et al., 2004; Fortes and Navas-Castillo, 2012; Lozano et al., 2004; Morris et al., 2006; Segev et al., 2004; Solórzano-Morales et al., 2011; Trenado et al., 2007; Tsai et al., 2004; Wintermantel and Wisler, 2006; Vargas et al., 2011).
Genetic exchanges through reassortment and recombination are major evolutionary factors for RNA plant viruses (Aranda et al., 1997; Domingo and Holland, 1994; Nagy, 2008; Simon and Bujarski, 1994), that can result in differences in symptom severity, host range, or transmission efficiency of plant viruses (Thekke-Veetil et al., 2015). Virus reassortment is a process of genetic recombination for multipartite (segmented) RNA viruses that occurs in host cells co-infected with multiple viruses and generates hybrid progeny viruses with novel genome combinations (Marshall et al., 2013; Vijaykrishna et al., 2015). Despite the importance of reassortment for plant viruses that can affect the production of economically important crops, many related studies on virus reassortment have focused on influenza virus and other viruses infecting humans or animals (Barton et al., 2014; Fuller et al., 2013; Savory et al., 2014; Wille et al., 2011).
In this study, we report the viral genome sequences of 10 ToCV isolates obtained from Korea, and present results of phylogenetic analyses among these isolates and ToCV isolates from other countries that provide evidence of reassortment of two viral segments originating from two geographically separated groups.

Materials and Methods

Sample collection, total RNA extraction and RT-PCR

In 2013 and 2014, a total of 394 samples of tomato leaves showing interveinal chlorosis and bronzing were collected from 11 tomato cultivation areas (Yeoju, Gwangju, Nonsan, Iksan, Yeonggwang, Hwasun, Hampyeong, Jeju, Seogwipo, Pyeongtaek and Buyeo) (Fig. 1, Table 1). ToCV-specific primers were designed based on the viral genome sequence of isolate Gr-535 RNA2 (EU284744.1) retrieved from the GenBank database using the Primer3 program (Rozen and Skaletsky, 2000). The primer sequences were as follows: ToCV-RNA2-1F (5′-ACCTTGGCAGGTTGTGAAAC-3′) and ToCV-RNA2-1R (5′-CGATATCTGGTGGGAGGCTA-3′). Total RNA was extracted from leaf samples using Viral Gene-spin™ Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). cDNA was synthesised from extracted total RNA using AMV Reverse Transcriptase (Promega, Madison, WI, USA) and ToCV specific primer (ToCVRNA2-1R). PCR was conducted using a ToCV-specific primer set (ToCV-RNA2-1F and ToCV-RNA2-1R) and GoTaq® Flexi DNA Polymerase (Promega) in a T100™ thermal cycler (Bio-Rad, Hercules, CA, USA) under the following conditions: initial denaturation at 95°C for 3 min; 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C; and a final extension step at 72°C for 5 min. The expected size of the RT-PCR product is 827 bp.

Full-length genome sequencing of the ToCV Korean isolates

To determine full-length nucleotide sequences, RT-PCR was performed with primers designed based on the previously reported ToCV sequences (GenBank accession numbers: AY903447.1 and KJ815045.1) (Table 2). Viral genome amplification was conducted using LA Taq DNA polymerase (Takara, Tokyo, Japan) in a T100™ thermal cycler (Bio-Rad) under the following conditions: initial denaturation at 95°C for 3 min; 35 cycles of 30 s at 94°C, 30 s at 55°C and 3 min at 72°C; and a final extension step at 72°C for 5 min. Full-length nucleotide sequences of RNA1 and RNA2 were acquired by combining three overlapping RT-PCR products (Fig. 2). Rapid amplification of cDNA ends (RACE) was performed to determine the 5′ and 3′ ends of the viral genomic segments. The amplified PCR products were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and sequenced (Macrogen, Seoul, Korea).

Sequence analysis

Full genome sequences were assembled using the DNASTAR software (DNASTAR, Madison, WI, USA) and compared by a BLAST search (https://blast.ncbi.nlm.nih.gov) with previously reported sequences in the GenBank database (Johnson et al., 2008). Identification of open reading frames was performed by the ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder).
Complete sequences of the 10 ToCV isolates from Korea and eight previously reported isolates was used to examine population genetics. The nucleotide sequences were aligned using the Clustal X and DNAstar programs (Thompson et al., 2002). Phylogenetic analyses of the complete genome sequences were performed by the maximum likelihood method implemented in the MEGA6 program (Tamura et al., 2013). Statistical significance of tree branching was assessed by performing 1000 bootstrap replications. The Geneious software (Biomatters, Auckland, New Zealand) was used to analyse nucleotide identities (Kearse et al., 2012). Pairwise genetic distances was analysed by Kimura’s two-parameter method using the MEGA6 program (Kimura, 1980; Tamura et al., 2013). Database accession numbers and the complete sequences for the isolates used in the phylogenetic and similar analyses in this study are shown in Table 3.

Results and Discussion

Outbreak of viral infection in tomato plants in Korea

In January 2013, tomato plants showing virus-like symptoms of yellowing, bronzing, and chlorosis on lower leaves was found in Iksan, Korea (Fig. 1). Total RNAs were then extracted from all samples and tested by RT-PCR using ToCV specific primers. ToCV-specific amplicons were detected from symptomatic samples in Iksan. To examine distribution and occurrence pattern of ToCV, during the period from 2013 to 2014, a total of 394 samples of symptomatic tomatoes were collected 11 tomato cultivation regions in Korea. Among the 394 samples, 178 were found to be infected with ToCV based on RT-PCR analysis (Table 1). RT-PCR products were sequenced, and BLAST results showed a high sequence identity (> 97%) with previously reported ToCV isolates. Most samples (79.2%) infected with ToCV were co-infected with TYLCV, which showed 99-100% similarity to previously reported sequence of a Korean isolate (GenBank accession number: JN680149.1).

Molecular characterization of Korean ToCV isolates

To examine molecular genetic structure of ToCV population in Korea, the complete nucleotide sequences of 10 ToCV Korean isolates identified in 2013 (except for isolates from Yeoju and Gwangju areas where only one individual was identified) were determined and deposited to the GenBank database (GenBank accession numbers are provided in Table 3). Comparison of the complete nucleotide sequences of the ToCV Korean isolates with all ToCV isolates available on the NCBI database showed overall sequence identities ranging from 97.4 to 99.7% for RNA1 and from 97.5 to 99.7% for RNA2 (data not shown). ToCV RNA1 consisted of four open reading frames (ORFs), as previously reported, and the complete genomic sequences of RNA2 of the ToCV Korean isolates were confirmed as containing nine ORFs (Fig. 2).

Genetic structure of the ToCV population

The MEGA 6.0 program was used to construct a phylogenetic tree using 10 complete sequences determined in this study and eight complete sequences retrieved from the GenBank database (Table 2). Phylogenetic trees constructed using the full-length nucleotide sequences of ToCV RNA1 and RNA2 revealed that the ToCV isolates could be clustered into three groups (Fig. 3). Our results suggested that the ToCV isolates from Jeju, Hwasun, and Hampyeong belong to the same group as isolates from Greece and Brazil (Clade 1), whereas the isolates from Iksan and Nonsan were similar to the isolates from the USA and China (Clade 2) (Fig. 3). In particular, for the isolates from Yeonggwang (ToCV-YG, JN1 and JN2), RNA1 was closer to the isolates from the USA and China in Clade 2 than those from Greece and Brazil, whereas RNA2 showed the opposite tendency, with these isolates in Clade 1 (Fig. 3, 4). From a geographical point of view, the isolates collected from northern areas of Yeonggwang belonged to group 1, while those from the southern area of Iksan were included in group 2 (Fig. 4). This clustering of the ToCV population was further supported by nucleotide diversity analyses. The genetic diversities within and between sub-populations, which were designated based on the phylogenetic trees, were estimated by Kimura’s two-parameter method (Kimura, 1980). The analyses showed that the genetic diversities within subpopulations were somewhat lower compared with those between subpopulations (Table 4). Although ToCV is an RNA virus, population analyses of the ToCV isolates showed high conservation and low molecular variation among the isolates. However, the concatenated sequences of entire genomes (i.e., RNA1 + RNA2) of ToCV isolates strictly indicate that reassortment (Table 4, Fig. 3). Genetic reassortment is an important evolutionary event in the diversification of RNA viruses.
In this study, it is confirmed that ToCV isolates in Korea are grouped into two clades based on the phylogenetic analyses. This clustering makes it possible to hypothesize that the ToCV isolates found in Korea have at least two different origins, which can be separated geographically. However, this hypothesis cannot be proven only by the clues provided in this study. In order to prove this, it is necessary to obtain information on the inflow of viruliferous whitefly or ToCV infected plants at the early stage of virus occurrence, but it is not easy to confirm this.
We also found that genetic exchanges have occurred by segment reassortment in natural ToCV populations. Phylogenetic analyses of three Korean isolates (ToCV YG, JN1 and JN2) provided a significant clue to reassortment between two different groups. This means that another ressortment inducing more severe economic damage may occur when ToCV strain(s) that differ from those previously reported arise and are introduced.

Acknowledgments

This research was supported by a grant from the Agenda Program (PJ012013) funded by the Rural Development Administration of Korea and a fund (Project Code No. Z-1543086-2017-21-01) by Research of Animal and Plant Quarantine Agency, South Korea.

Fig. 1
Occurrence of ToCV in Korea. (A) Symptomatic tomato leaves from Iksan showing interveinal leaf chlorosis. (B) Geographic locations of sampling sites.
ppj-34-199f1.gif
Fig. 2
Schematic diagram of RT-PCR-based strategy for fulllength genome sequencing of ToCV.
ppj-34-199f2.gif
Fig. 3
Molecular Phylogenetic analysis of ToCV RNA1 (A) and RNA2 (B) using the maximum likelihood method. The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model (Tamura and Nei, 1993). The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 18 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013). ToCV isolated were grouped into three clades [clade 1 (red), 2 (blue) and 3 (green)] and two segments (RNA1 and RNA2) belonged to different clades in the case of isolates JN1, JN2 and YG (purple).
ppj-34-199f3.gif
Fig. 4
Geographic distribution of ToCV isolates in Korea. ToCV isolates from tomato were clustered into three subpopulations based on the phylogenetic analysis.
ppj-34-199f4.gif
Table 1
Infection prevalence of ToCV in collected tomato samples
Years Provinces Region Number of sample(s) Infection prevalence (%)

Collected ToCV-infected
2013 Gyeonggi-do Yeoju 2 1 50
Gwangju 1 1 100
Chungcheongnam-do Nonsan 3 3 100
Jeollabuk-do Iksan 43 41 95.35
Jeollanam-do Yeonggwang 13 10 76.92
Hwasun 19 15 78.95
Hampyeong 29 7 24.14
Jeju-do Jeju 63 20 31.75
Seogwipo 65 26 40.00
2014 Gyeonggi-do Pyeongtaek 5 2 40.00
Chungcheongnam-do Buyeo 30 1 3.33
Jeollabuk-do Iksan 95 37 38.95
Jeollanam-do Hwasun 1 1 100.00
Jeju-do Jeju 13 9 69.23
Seogwipo 12 4 33.33
Total 394 178 45.18
Table 2
Primer sets for ToCV full-length genome sequencing
Primers Sequences (5′-3′) Target region
RNA1
 For RACE
  ToCV-R1-5′RV GTTCATGCGAGTTTTTATCC 407-426
  Xec AAAGAATTCCCCCCCCCCCCC
  ToCV-RNA1-3′3f TAAAGTAATCATCAGAGTGTATC 7950-7972
  ToCV-RNA1-3′1r TTTTTTTTTTTTTTCGACCTATTTATTTA
 For reverse transcription (RT)
  ToCV-R1-1r ACATTTCACGAACGCATTTC 3671-3690
  ToCV-R1-2r ATACTGTCCGGTCTCGTCC 6404-6422
  ToCV-R1-3r CCAAAGGAAGGAAACATTATCA 8428-8449
 For RT-PCR and sequence analysis
  ToCV-R1-1F GTTCAGTGTCGACCTTATCA 94-113
  ToCV-R1-1R GCCCCTTCATCTCTTTAGCA 3482-3501
  ToCV-R1-2F CGATCCTCGGTGATTCTATC 3070-3089
  ToCV-R1-2R AAACTCCCCTGCGACATAAG 6353-6372
  ToCV-R1-3F CAGTCCGGATGTGAAGATGA 5801-5820
  ToCV-R1-3R CCACCTAAAATGACCTGACC 8192-8211
 For sequence analysis
  ToCV-R1-1u TTCTCTGTGGTGTGATAGTTTC 899-920
  ToCV-R1-1d TTCTTGGCCCTGTACTGA 2681-2698
  ToCV-R1-2u TTGGATGCGTTATCACTCTA 3356-3375
  ToCV-R1-2d GGCATCACTCAAAAGAAGAC 4738-4757
  ToCV-R1-3u GTGGCTGACGATTCTATTTC 4629-4648
  ToCV-R1-3d GCAACCTTATCCAAAGATGA 6078-6097
  ToCV-R1-4u GAGACCGGACAGTATGAAAC 6408-6427
  ToCV-R1-4d GCACGTTGTATCGTAATCAA 7493-7512
RNA2
 For RACE
  ToCV-R2-5′R CCGACTTCGAAAGTGCAGAG 395-414
  Xec AAAGAATTCCCCCCCCCCCCC
  ToCV-RNA2-3′2f GTGAAATTGACAGAAGGTTGAGTA 7659-7682
  ToCV-RNA2-3′2r TTTTTTTTTTTTTCGAGGTATTTATTTAT
 For reverse transcription
  ToCV-R2-1r GTCAGTTGTGCAGTCGGTTC 3017-3036
  ToCV-R2-2r TGACGTAATCCCCAACCAA 5579-5597
  ToCV-R2-3r CGAAGTAAATAACCCGAAGAAG 8094-8115
 For RT-PCR and sequence analysis
  ToCV-R2-1F TAATTACCCCACCGTCACTA 53-72
  ToCV-R2-1R TTGTGCAGTCGGTTCTTCAC 3012-3031
  ToCV-R2-2F GAGTCATGGAACCCGTTGATA 2559-2579
  ToCV-R2-2R AACCATCCAGAAAGTCTCAC 5354-5373
  ToCV-R2-3F AGGTTAGACCCAAAATGTCC 4804-4823
  ToCV-R2-3R AAACCTGTTACTCCCGAATG 7985-8004
 For sequence analysis
  ToCV-R2-1u ACATTCCAACTTGTCTCTCC 835-854
  ToCV-R2-1d TTGCCAGTGGTTTTATTAGC 2130-2149
  ToCV-R2-2u CAAAAACTGATAACGCTGAA 3123-3142
  ToCV-R2-2d TCTTCTCGAACTCCTCTTCC 4586-4605
  ToCV-R2-3u TTTACCTAACCCGAGTCTGA 5647-5666
  ToCV-R2-3d AATTGTACACGACCTCCATC 7126-7145
Table 3
ToCV isolates analyzed in this study
Virus isolates Countries Years GenBank accession no. References

RNA1 RNA2
ToCV_Florida1 USA 2005 NC_007340.1 NC_007341.1 Wintermantel et al., 2005
ToCV_Florida2 USA 2005 AY903447.1 AY903448.1 Wintermantel et al., 2005
ToCV_ToC-Br2 Brazil 2006 JQ952600.1 JQ952601.1 Albuquerque et al., 2012
ToCV_AT80/99 Spain 2006 DQ983480.1 DQ136146.1 Lozano et al., 2006
ToCV_Gr-535 Greece 2008 EU284745.1 EU284744.1 Kataya et al., 2008
ToCV_BJ China 2013 KC887998.1 KC887999.1 Zhao et al., 2013a
ToCV_SDSG China 2013 KC709509.1 KC709510.1 Zhao et al., 2015
ToCV_AT80/99-IC Spain 2014 KJ740256.1 KJ740257.1 Orílio et al., 2014
ToCV_JJ3 Korea (Jeju) 2013 KP114532.1 KP114533.1 This study
ToCV_JJ5 Korea (Jeju) 2013 KP114527.1 KP114534.1 This study
ToCV_IS17 Korea (Iksan) 2013 KP114535.1 KP114525.1 This study
ToCV_IS29 Korea (Iksan) 2013 KP114538.1 KP114529.1 This study
ToCV_HS Korea (Hwasun) 2013 KP137098.1 KP137099.1 This study
ToCV_HP Korea (Hampyeong) 2013 KP114530.1 KP114537.1 This study
ToCV_YG Korea (Yeonggwang) 2013 KP114526.1 KP114528.1 This study
ToCV_JN1 Korea (Yeonggwang) 2013 KP114531.1 KP114536.1 This study
ToCV_JN2 Korea (Yeonggwang) 2013 MG813909.1 MG813910.1 This study
ToCV_NS Korea (Nonsan) 2013 MG813908.1 MG813911.1 This study
Table 4
Genetic diversity of population of ToCV RNA1 and RNA2. Analyses were conducted using the Kimura 2-parameter model (Kimura, 1980). The analysis involved three clades. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013)
Populationa Nucleotide diversity between subpopulationsb

Clade 1 Clade 2 Clade 3
RNA1
 Clade 1 0.00196 ± 0.00027
 Clade 2 0.00603 ± 0.00097 0.00156 ± 0.00027
 Clade 3 0.00750 ± 0.00087 0.00507 ± 0.00056 0.00496 ± 0.00056
RNA2
 Clade 1 0.00412 ± 0.00047
 Clade 2 0.00741 ± 0.00088 0.00100 ± 0.00026
 Clade 3 0.00864 ± 0.00086 0.00535 ± 0.0066 0.00472 ± 0.00064

a Subpopulations were designated based on the phylogenetic trees shown in Fig. 3.

b Numeric values indicate nucleotide diversity ± standard error.

References

Abou-Jawdah, Y, El Mohtar, C, Atamian, H and Sobh, H 2006. First report of Tomato chlorosis virus in Lebanon. Plant Dis. 90:378
crossref
Accotto, G, Vaira, A, Vecchiati, M, Finetti Sialer, M, Gallitelli, D and Davino, M 2001. First report of Tomato chlorosis virus in Italy. Plant Dis. 85:1208
crossref
Albuquerque, LC, Varsani, A, Fernandes, FR, Pinheiro, B, Martin, DP, Ferreira, PDTO, Lemos, TO and Inoue-Nagata, AK 2012. Further characterization of tomato-infecting begomoviruses in Brazil. Arch Virol. 157:747-752.
crossref pmid
Alvarez-Ruiz, P, Jimenez, C, Leyva-López, NE and Méndez-Lozano, J 2007. First report of Tomato chlorosis virus infecting tomato crops in Sinaloa, Mexico. Plant Pathol. 56:1043
crossref
Aranda, MA, Fraile, A, Dopazo, J, Malpica, JM and García-Arenal, F 1997. Contribution of mutation and RNA recombination to the evolution of a plant pathogenic RNA. J Mol Evol. 44:81-88.
crossref pmid pmc
Arruabarrena, A, Rubio, L, González-Arcos, M, Maeso, D, Fonseca, M and Boiteux, L 2015. First report of Tomato chlorosis virus infecting tomato crops in Uruguay. Plant Dis. 99:895
crossref
Barbosa, J, Teixeira, A, Moreira, A, Camargo, L, Filho, AB, Kitajima, E and Rezende, J 2008. First report of Tomato chlorosis virus infecting tomato crops in Brazil. Plant Dis. 92:1709
crossref
Barbosa, J, Teixeira, L and Rezende, J 2010. First report on the susceptibility of sweet pepper crops to Tomato chlorosis virus in Brazil. Plant Dis. 94:374
crossref
Barton, HD, Rohani, P, Stallknecht, DE, Brown, J and Drake, JM 2014. Subtype diversity and reassortment potential for co-circulating avian influenza viruses at a diversity hot spot. J Anim Ecol. 83:566-575.
crossref pmid pmc
Bese, G, Bóka, K, Krizbai, L and Takács, A 2011. First report of Tomato chlorosis virus in tomato from Hungary. Plant Dis. 95:363
crossref
Castro, R, Hernandez, E, Mora, F, Ramirez, P and Hammond, R 2009. First report of Tomato chlorosis virus in tomato in Costa Rica. Plant Dis. 93:970
crossref
Çevik, B and Erkıß, G 2008. First report of Tomato chlorosis virus in Turkey. Plant Pathol. 57:767-767.
crossref
Dalmon, A, Bouyer, S, Cailly, M, Girard, M, Lecoq, H, Desbiez, C and Jacquemond, M 2005. First report of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato crops in France. Plant Dis. 89:1243
crossref
Domingo, E and Holland, JJ 1994. Mutation rates and rapid evolution of RNA viruses. In: The evolutionary biology of viruses, eds. by SS Morse, 161-184. Raven Press, NY, USA.
Dovas, C, Katis, N and Avgelis, A 2002. Multiplex detection of criniviruses associated with epidemics of a yellowing disease of tomato in Greece. Plant Dis. 86:1345-1349.
crossref pmid
Fiallo-Olivé, E, Hamed, A, Moriones, E and Navas-Castillo, J 2011. First report of Tomato chlorosis virus infecting tomato in Sudan. Plant Dis. 95:1592
crossref
Font, M, Juárez, M, Martínez, O and Jordá, C 2004. Current status and newly discovered natural hosts of Tomato infectious chlorosis virus and Tomato chlorosis virus in Spain. Plant Dis. 88:82
crossref
Fortes, IM and Navas-Castillo, J 2012. Potato, an experimental and natural host of the crinivirus Tomato chlorosis virus. Eur J Plant Pathol. 134:81-86.
crossref
Fuller, TL, Gilbert, M, Martin, V, Cappelle, J, Hosseini, P, Njabo, KY, Aziz, SA, Xiao, X, Daszak, P and Smith, TB 2013. Predicting hotspots for influenza virus reassortment. Emerg Infect Dis. 19:581-588.
crossref pmid pmc
Hanssen, IM, Lapidot, M and Thomma, BP 2010. Emerging viral diseases of tomato crops. Mol Plant-Microbe Interact. 23:539-548.
crossref pmid
Hirota, T, Natsuaki, T, Murai, T, Nishigawa, H, Niibori, K, Goto, K, Hartono, S, Suastika, G and Okuda, S 2010. Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan. J Gen Plant Pathol. 76:168-171.
crossref
Jacquemond, M, Verdin, E, Dalmon, A, Guilbaud, L and Gognalons, P 2009. Serological and molecular detection of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato. Plant Pathol. 58:210-220.
crossref
Johnson, M, Zaretskaya, I, Raytselis, Y, Merezhuk, Y, McGinnism, S and Madden, TL 2008. NCBI BLAST: a better web interface. Nucleic Acids Res. 36:W5-W9.
crossref pmid pmc
Karasev, AV 2000. Genetic diversity and evolution of closteroviruses. Annu Rev Phytopathol. 38:293-324.
crossref pmid
Kataya, A, Stavridou, E, Farhan, K and Livieratos, I 2008. Nucleotide sequence analysis and detection of a Greek isolate of Tomato chlorosis virus. Plant Pathol. 57:819-824.
crossref
Kearse, M, Moir, R, Wilson, A, Stones-Havas, S, Cheung, M, Sturrock, S, Buxton, S, Cooper, A, Markowitz, S and Duran, C 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 28:1647-1649.
crossref pmid pmc
Kimura, M 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 16:111-120.
crossref pmid
Lett, J, Hoareau, M, Reynaud, B, Saison, A, Hostachy, B, Lobin, K and Benimadhu, S 2009. First report of Tomato chlorosis virus in tomato on Mauritius Island. Plant Dis. 93:111
crossref
Liu, H-Y, Wisler, G and Duffus, J 2000. Particle lengths of whitefly-transmitted criniviruses. Plant Dis. 84:803-805.
crossref pmid
Louro, D, Accotto, G and Vaira, A 2000. Occurrence and diagnosis of Tomato chlorosis virus in Portugal. Eur J Plant Pathol. 106:589-592.
crossref pdf
Lozano, G, Moriones, E and Navas-Castillo, J 2004. First report of sweet pepper (Capsicum annuum) as a natural host plant for Tomato chlorosis virus. Plant Dis. 88:224
crossref
Lozano, G, Moriones, E and Navas-Castillo, J 2006. Complete nucleotide sequence of the RNA2 of the crinivirus Tomato chlorosis virus. Arch Virol. 151:581-587.
crossref pmid
Marshall, N, Priyamvada, L, Ende, Z, Steel, J and Lowen, AC 2013. Influenza virus reassortment occurs with high frequency in the absence of segment mismatch. PLoS Pathog. 9:e1003421
crossref pmid pmc
Morris, J, Steel, E, Smith, P, Boonham, N, Spence, N and Barker, I 2006. Host range studies for Tomato chlorosis virus, and Cucumber vein yellowing virus transmitted by Bemisia tabaci (Gennadius). Eur J Plant Pathol. 114:265-273.
crossref
Nagy, PD 2008. Recombination in plant RNA viruses. Plant virus evolution. 133-156. Springer,
crossref
Orílio, AF, Fortes, IM and Navas-Castillo, J 2014. Infectious cDNA clones of the crinivirus Tomato chlorosis virus are competent for systemic plant infection and whitefly-transmission. Virology. 464:365-374.
crossref pmid
Rozen, S and Skaletsky, H 2000. Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols Methods in Molecular Biology™, 132:eds. by S Misener and SA Krawetz, Humana Press, Totowa, NJ.
crossref
Savory, FR, Varma, V and Ramakrishnan, U 2014. Identifying geographic hot spots of reassortment in a multipartite plant virus. Evol Appl. 7:569-579.
crossref pmid pmc
Segev, L, Wintermantel, W, Polston, J and Lapidot, M 2004. First report of Tomato chlorosis virus in Israel. Plant Dis. 88:1160
crossref
Simon, A and Bujarski, J 1994. RNA-RNA recombination and evolution in virus-infected plants. Annu Rev Phytopathol. 32:337-362.
crossref
Solórzano-Morales, A, Barboza, N, Hernández, E, Mora-Umaña, F, Ramírez, P and Hammond, R 2011. Newly discovered natural hosts of Tomato chlorosis virus in Costa Rica. Plant Dis. 95:497
crossref
Sundaraj, S, Srinivasan, R, Webster, C, Adkins, S, Perry, K and Riley, D 2011. First report of Tomato chlorosis virus infecting tomato in Georgia. Plant Dis. 95:881
crossref
Tamura, K and Nei, M 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10:512-526.
pmid
Tamura, K, Stecher, G, Peterson, D, Filipski, A and Kumar, S 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 30:2725-2729.
crossref pmid pmc
Thekke-Veetil, T, Polashock, JJ, Marn, MV, Plesko, IM, Schilder, AC, Keller, KE, Martin, RR and Tzanetakis, IE 2015. Population structure of blueberry mosaic associated virus: Evidence of reassortment in geographically distinct isolates. Virus Res. 201:79-84.
crossref pmid
Thompson, JD, Gibson, T and Higgins, DG 2002. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. 2:2-3.
crossref
Trenado, HP, Fortes, IM, Louro, D and Navas-Castillo, J 2007. Physalis ixocarpa and P. peruviana, new natural hosts of Tomato chlorosis virus. Eur J Plant Pathol. 118:193-196.
crossref
Tsai, W, Shih, S, Green, S, Hanson, P and Liu, H 2004. First report of the occurrence of Tomato chlorosis virus and Tomato infectious chlorosis virus in Taiwan. Plant Dis. 88:311
crossref
Vargas, J, Hammond, R, Hernández, E, Barboza, N, Mora, F and Ramírez, P 2011. First report of Tomato chlorosis virus infecting sweet pepper in Costa Rica. Plant Dis. 95:1482
crossref
Vijaykrishna, D, Mukerji, R and Smith, GJ 2015. RNA virus reassortment: an evolutionary mechanism for host jumps and immune evasion. PLoS Pathog. 11:e1004902
crossref pmid pmc
Wille, M, Robertson, GJ, Whitney, H, Bishop, MA, Runstadler, JA and Lang, AS 2011. Extensive geographic mosaicism in avian influenza viruses from gulls in the northern hemisphere. PLoS One. 6:e20664
crossref pmid pmc
Wintermantel, W, Polston, J, Escudero, J and Paoli, E 2001. First report of Tomato chlorosis virus in Puerto Rico. Plant Dis. 85:228
crossref
Wintermantel, W, Wisler, G, Anchieta, A, Liu, H-Y, Karasev, A and Tzanetakis, I 2005. The complete nucleotide sequence and genome organization of Tomato chlorosis virus. Arch Virol. 150:2287-2298.
crossref pmid
Wintermantel, WM and Wisler, GC 2006. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 90:814-819.
crossref pmid
Wisler, G, Duffus, J, Liu, H-Y and Li, R 1998a. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Dis. 82:270-280.
crossref pmid
Wisler, G, Li, R, Liu, H-Y, Lowry, D and Duffus, J 1998b. Tomato chlorosis virus: a new whitefly-transmitted, phloem-limited, bipartite closterovirus of tomato. Phytopathology. 88:402-409.
crossref
Zhao, L-M, Li, G, Gao, Y, Zhu, Y-R, Liu, J and Zhu, X-P 2015. Reverse transcription loop-mediated isothermal amplification assay for detecting Tomato chlorosis virus. J Virol Methods. 213:93-97.
crossref pmid
Zhao, LM, Li, G, Gao, Y, Liu, YJ, Sun, GZ and Zhu, XP 2014. Molecular detection and complete genome sequences of Tomato chlorosis virus isolates from infectious outbreaks in China. J Phytopathol. 162:627-634.
crossref
Zhao, R, Wang, N, Wang, R, Chen, H, Shi, Y, Fan, Z and Zhou, T 2013a. Characterization and full genome sequence analysis of a Chinese isolate of Tomato chlorosis virus. Acta Virol. 58:92-94.
crossref
Zhao, R, Wang, R, Wang, N, Fan, Z, Zhou, T, Shi, Y and Chai, M 2013b. First Report of Tomato chlorosis virus in China. Plant Dis. 97:1123
crossref


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next